Entry information : EcamPrx85 (EcC055188.30)
Entry ID 10330
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx85 (EcC055188.30)
Name (synonym) EcamPrx85 (EcC055188.30)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx85
start..stop
S start..stop
EgrPrx85 650 0 1..319 1..319
EglPrx85 645 0 1..319 1..319
EguPrx85 639 0 1..319 1..319
GmPrx324 426 3e-151 20..319 24..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..210 210 N° 2 665..1016 352 N° 3 1413..1807 395  
join(1..210,665..1016,1413..1807)


exon

Literature and cross-references EcamPrx85 (EcC055188.30)
Protein sequence: EcamPrx85 (EcC055188.30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (296)
PWM (Da):   %s   34895.64 (32564.5)  
PI (pH):   %s   6.5 (6.50) Peptide Signal:   %s   cut: 24 range:24-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRAQCIGMAALLMAVWIGVSDGQLAYDYYKTTCPNAEDIVRREMLSFAFLDATAPAAFLRLMFHDCQVQGCDASILLDPIGSKSEIKSSRNFGIRKLDAIEYVKSALEAECPGQVSCADIVALAARESVALSGGPHIAIPLGRKDSRSSNYQQADAHLPSPSISVDAFLHIFMTKGLTLEESVAILGAHTLGAGHCLNIIDRLYNPKPDDLMNPVFEAWLRLQCPTLNPLMNLTATSNDITPTIFDNQYYRDILLGKGLFFIDSSISRDPRTSDIVKQFAIDQDYFFRAFSSAFVKLSSANTLSKTKGEVRKQCSRV

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGGGCTCAGTGCATAGGAATGGCAGCATTATTGATGGCTGTGTGGATTGGGGTGAGTGATGGTCAGCTGGCTTATGATTACTACAAGACAACATGTCCAAATGCTGAGGACATT
GTCAGGAGGGAGATGCTGAGCTTTGCTTTCTTGGATGCAACTGCACCCGCTGCCTTTCTCAGGCTCATGTTTCACGACTGCCAAGTTCAG
GTAACCATCACTTCATACACACAACCGCTC
CATCATTTCCTCAATCATGCATGGTGTCATGTTGTGTCTGTGTATCCTCTGAAGACAGAGAGAGAGAGAGAGAGAGAGAGAGACGTACATAAATGCATGAAAGTTAGACTGCACTCCCTA
CCTACATTGATCTCAGAACATACAAAGAGATTTTCTTACCATAACTAACATATTCCAGAGTCATAGCATTCGGCTTCTCAATTGAATACATCCCTTTTTTACAACTCCCATTTCCTGGAA
TGTTAAACATTATTGTAGAACACCTTTGAAAACATGTTTTTTGAGTTGGTGTTGCACTGAGAGTTCTCTTTTTCTCTCTCTAGGGAGATACTGAGAGTGCATTATCCTTTGTTTAGTTGA
TAATATCTCGAGCTTGTTGCTTTCTTCCATAACTACATGATAACAATACTTCTCATTTTTTTAGGGATGCGATGCTTCGATACTTCTCGACCCGATTGGCTCGAAGTCGGAGATAAAATC
GTCGAGGAACTTCGGCATCAGGAAACTCGATGCGATCGAGTATGTCAAGTCGGCATTGGAAGCCGAATGCCCGGGCCAGGTATCTTGTGCAGACATAGTTGCACTAGCTGCAAGAGAATC
GGTGGCTCTAAGTGGAGGACCACACATTGCCATTCCTCTTGGAAGGAAAGACTCGAGATCTAGTAATTACCAGCAAGCCGATGCTCATCTCCCTTCTCCAAGTATTTCTGTCGATGCATT
CCTCCATATCTTCATGACTAAAGGGCTGACTCTCGAGGAATCAGTCGCGATCTTGG
GTAAGAATCATGTATCATTAATCTCGATATTGATCAACTAAACACATCGGCAGAGCTTGTCCTA
ATCAGGGGCATTAATGAATCTAATATGTGAATAAACTAAGCCTGATAGACTCTTCAAAAGGAGATTCTGCCGATCACGGCTAGTCCAGTATCAGAGTACGGTTTTTGCTTTAGCTAATGT
GATACCAACGTACCTGTTTTGCGACATACTTGTTCATAGAAGTAGAACTCCATAGCGATTGTATGTAGATAATATTTTGCACATTGAAGATCGACCGATCCTTTTTGTTTGTAACATGAA
TTTGAGCTGCTGTAACCATTTAGAATGAATAAAGACTAGTGCTGATCCGTACTAACAAGTACGGACACTGCCGTGTGAACCGCTCTTTGCAGGTGCACATACACTAGGCGCCGGACACTG
CCTGAACATCATCGACAGATTGTACAACCCGAAACCCGACGATCTAATGAACCCAGTGTTCGAAGCTTGGCTCAGACTACAGTGCCCAACTCTAAATCCCCTAATGAATCTCACAGCCAC
ATCCAACGACATAACCCCAACAATATTCGATAACCAGTACTACAGGGACATATTGTTGGGCAAGGGCTTGTTTTTCATCGACTCAAGCATCTCAAGAGATCCTCGCACTTCTGACATCGT
CAAGCAGTTCGCCATTGATCAGGACTACTTCTTTCGCGCATTCTCTTCAGCATTTGTCAAGCTCTCTTCAGCCAACACCCTCAGCAAGACGAAGGGCGAAGTGCGGAAGCAATGCAGCAG
GGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGGGCTCAGTGCATAGGAATGGCAGCATTATTGATGGCTGTGTGGATTGGGGTGAGTGATGGTCAGCTGGCTTATGATTACTACAAGACAACATGTCCAAATGCTGAGGACATT
GTCAGGAGGGAGATGCTGAGCTTTGCTTTCTTGGATGCAACTGCACCCGCTGCCTTTCTCAGGCTCATGTTTCACGACTGCCAAGTTCAG
GGATGCGATGCTTCGATACTTCTCGACCCG
ATTGGCTCGAAGTCGGAGATAAAATCGTCGAGGAACTTCGGCATCAGGAAACTCGATGCGATCGAGTATGTCAAGTCGGCATTGGAAGCCGAATGCCCGGGCCAGGTATCTTGTGCAGAC
ATAGTTGCACTAGCTGCAAGAGAATCGGTGGCTCTAAGTGGAGGACCACACATTGCCATTCCTCTTGGAAGGAAAGACTCGAGATCTAGTAATTACCAGCAAGCCGATGCTCATCTCCCT
TCTCCAAGTATTTCTGTCGATGCATTCCTCCATATCTTCATGACTAAAGGGCTGACTCTCGAGGAATCAGTCGCGATCTTGG
GTGCACATACACTAGGCGCCGGACACTGCCTGAACATC
ATCGACAGATTGTACAACCCGAAACCCGACGATCTAATGAACCCAGTGTTCGAAGCTTGGCTCAGACTACAGTGCCCAACTCTAAATCCCCTAATGAATCTCACAGCCACATCCAACGAC
ATAACCCCAACAATATTCGATAACCAGTACTACAGGGACATATTGTTGGGCAAGGGCTTGTTTTTCATCGACTCAAGCATCTCAAGAGATCCTCGCACTTCTGACATCGTCAAGCAGTTC
GCCATTGATCAGGACTACTTCTTTCGCGCATTCTCTTCAGCATTTGTCAAGCTCTCTTCAGCCAACACCCTCAGCAAGACGAAGGGCGAAGTGCGGAAGCAATGCAGCAGGGTGAAC

Retrieve as FASTA