Entry information : EcamPrx68 ( EcC059480.10)
Entry ID 10333
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2016-02-05 (Christophe Dunand)
Sequence status partial
Reviewer Achraf Jemmat
Last annotation changes 2016-02-05 (Achraf Jemmat)
Peroxidase information: EcamPrx68 ( EcC059480.10)
Name (synonym) EcamPrx68 ( EcC059480.10)
Class Class III peroxidase     [Orthogroup: Prx020]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx68
start..stop
S start..stop
EgrPrx68 572 0 1..277 49..325
EglPrx68 572 0 1..277 49..325
EguPrx68 568 0 1..277 49..325
EgrPrx67 561 0 1..277 49..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..63 63 N° 2 166..363 198 N° 3 938..1507 570  
join(1..63,166..363,938..1507)


exon

Literature and cross-references EcamPrx68 ( EcC059480.10)
Protein sequence: EcamPrx68 ( EcC059480.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   277
PWM (Da):   %s   30029.15  
PI (pH):   %s   8.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
QQTFVTAPATLRLLFHDCFVRGCDGSVLIASPTNNAEKDHPDDLSLAGDGFDTVIKAKAAVDSVPQCKNKVSCADILALATRDVVSLAGGPFYSVELGRRDGRISTKLGVQHNLPQPGSKLDQLNSMFSSHGLSQTDMIALSGAHTIGFSHCGKFSKRIYNFSPRSSIDPTLNFRYALQLRQMCPINVDPRIAINMDPTTPQTFDNAYYKNLQQGKGLFVSDQTLFSDPRSRATVNLFASNNAAFQQAFVTAITKMGRIGVKTGNQGEIRIDCTRPN

Retrieve as FASTA  
Remarks Partial sequence from genomic. Join with EcS749707.10 (Incorrect prediction from kazusa (5' end is missing due to short contig)) and EcC059480.10 (Partial sequence from genomic. Incorrect prediction from kazusa (PS due to short contig) removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAGCAGACCTTCGTCACCGCCCCCGCAACTCTCCGCCTCTTGTTCCACGATTGCTTCGTCAGGGTTGGTTTTGAAACAAAGTATTCTATACATAATAATGTTGGCTTGATTGTTAATTGT
TTGCTTCTTCTACTTCTTTTTCGTTCGTTTTGGGGATTTGATTAGGGATGCGATGGTTCAGTGCTCATAGCGTCGCCCACCAACAATGCCGAGAAAGACCATCCCGATGACCTGTCGCTC
GCCGGCGACGGGTTCGACACTGTGATCAAAGCTAAGGCAGCAGTGGACAGTGTTCCTCAGTGCAAAAACAAAGTCTCTTGTGCCGATATCTTGGCTCTTGCCACTAGAGATGTCGTTTCG
TTG
GTACGATAAGGGCCCTCCACTGAAATCCTTTCCCAATTTTTTCATTTCACGAAATCGAGCATCAGTCTTAACTTTTTCAGTCCGGTGAAAAGCAAACCATTCATATTGAGCTCGAAA
ATTTATGAAAAATTACTTTAAAGGCACGTAGTTTTCGAACCCTTATAGAGTGCTCGACTATTTTCTTAGAATATACCAATATGCTTTTCTTTTCCACGACATGACGAAATTATAATATGC
TTTTGTTTTGTACGAAAGAAAAATAATAGTCTAATCATATAAACTTTTTAGTACAAATTTCTTTTCTTGTTACACTGAAAAATCATTGGGTCCCTTTCATAATGGCTGTCCTTTTCTCCC
TCCTCCGCATCAATAGCATGTATGGAAGTTTGATGCAACGGGTTATCAAGAAAGTCGACAACAAGCACCACCCAACGCTACTTTTTCCTGTCAAACCACTCAAAATTGCGATTGATTTTC
GTCCATTTTATTCTTTTCATTTTAGCAAATTGATAATGTCGCGCGGTCATTTCATAATCACTTGCTATTCTTTGCAAAATTCTGAAATTTTGTGTAGGCAGGGGGGCCGTTCTATAGTGT
TGAATTGGGGAGACGCGATGGAAGAATATCAACTAAACTTGGTGTCCAACACAATCTTCCTCAGCCTGGTTCCAAATTGGACCAGCTCAATTCTATGTTCTCTTCTCATGGTCTCTCCCA
AACTGACATGATCGCCTTATCAGGTGCGCACACGATTGGATTCTCTCACTGCGGCAAATTCTCCAAGCGGATCTACAACTTCAGCCCGAGAAGCTCGATCGATCCGACCCTGAACTTCCG
CTACGCCTTGCAGCTGAGGCAGATGTGCCCGATCAACGTGGACCCCCGGATCGCCATCAACATGGACCCCACAACGCCTCAGACGTTCGACAACGCCTACTACAAGAACCTCCAACAAGG
AAAGGGCCTCTTCGTCTCCGACCAGACATTGTTCTCCGACCCGAGATCGAGGGCCACGGTCAACCTGTTCGCATCAAACAACGCGGCGTTCCAACAGGCCTTCGTCACTGCGATCACAAA
GATGGGTCGGATCGGGGTCAAGACTGGGAACCAGGGCGAGATTAGGATTGATTGCACTCGCCCCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAGCAGACCTTCGTCACCGCCCCCGCAACTCTCCGCCTCTTGTTCCACGATTGCTTCGTCAGGGGATGCGATGGTTCAGTGCTCATAGCGTCGCCCACCAACAATGCCGAGAAAGACCAT
CCCGATGACCTGTCGCTCGCCGGCGACGGGTTCGACACTGTGATCAAAGCTAAGGCAGCAGTGGACAGTGTTCCTCAGTGCAAAAACAAAGTCTCTTGTGCCGATATCTTGGCTCTTGCC
ACTAGAGATGTCGTTTCGTTG
GCAGGGGGGCCGTTCTATAGTGTTGAATTGGGGAGACGCGATGGAAGAATATCAACTAAACTTGGTGTCCAACACAATCTTCCTCAGCCTGGTTCCAAA
TTGGACCAGCTCAATTCTATGTTCTCTTCTCATGGTCTCTCCCAAACTGACATGATCGCCTTATCAGGTGCGCACACGATTGGATTCTCTCACTGCGGCAAATTCTCCAAGCGGATCTAC
AACTTCAGCCCGAGAAGCTCGATCGATCCGACCCTGAACTTCCGCTACGCCTTGCAGCTGAGGCAGATGTGCCCGATCAACGTGGACCCCCGGATCGCCATCAACATGGACCCCACAACG
CCTCAGACGTTCGACAACGCCTACTACAAGAACCTCCAACAAGGAAAGGGCCTCTTCGTCTCCGACCAGACATTGTTCTCCGACCCGAGATCGAGGGCCACGGTCAACCTGTTCGCATCA
AACAACGCGGCGTTCCAACAGGCCTTCGTCACTGCGATCACAAAGATGGGTCGGATCGGGGTCAAGACTGGGAACCAGGGCGAGATTAGGATTGATTGCACTCGCCCCAAC

Retrieve as FASTA