Entry information : EcamPrx39 ( EcC030987.10)
Entry ID 10346
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2013-10-30 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-11 (Christophe Dunand)
Peroxidase information: EcamPrx39 ( EcC030987.10)
Name (synonym) EcamPrx39 ( EcC030987.10)
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx39
start..stop
S start..stop
EgrPrx39 640 0 1..319 1..323
EguPrx39 637 0 1..319 1..323
EguPrx36 637 0 1..319 1..323
EguPrx33 637 0 1..319 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 327..361 35 N° 3 1751..1898 148 N° 4 2089..2637 549
join(1..228,327..361,1751..1898,2089..2637)


exon

Literature and cross-references EcamPrx39 ( EcC030987.10)
Protein sequence: EcamPrx39 ( EcC030987.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (296)
PWM (Da):   %s   34651.41 (32257.1)  
PI (pH):   %s   6.24 (6.24) Peptide Signal:   %s   cut: 24 range:24-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALNSLSLVQALLFLSLSTSAFSTRPYKEGLTPYFYDHVCPQALPAIKRVVEAAVQQERRMGASLLRLHFHDCFVNGCDASILLDPTLEKLAVPNNNSARGFEVIDQIKAEVDKACGYSLVSCADILAVAARDSVVLGGPSWEVQLGRRDSTTASRTTANSDIPAPNMDLPALINTFQKQGLDTRDLVALSGAHTIGFAQCFTFRNRTYNDDNIATSFARSLRSLCPRTGEDGNLAGLDPSPAQFDALYFHNLLAQKGLLHSDQALYSGGSTDELVKTYSDDAEAFWDDFAKSMIKMGNIKPLIGNQGQIRSNCRRLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTAAATAGCCTCAGCCTCGTCCAAGCACTTCTCTTCTTGTCTCTCTCGACCTCGGCTTTCTCGACGCGGCCCTACAAGGAAGGCCTCACGCCATACTTCTACGACCACGTTTGC
CCTCAAGCCTTGCCCGCCATCAAACGCGTTGTCGAGGCAGCGGTGCAACAGGAGCGACGCATGGGCGCTTCGTTACTCCGTTTGCACTTCCACGATTGTTTCGTTAAC
GTACGACACATT
CACGATAGCCTTGATTCGCATTGGTTATCTAGCAGCCGGCATAAATTTGCTAACTTGATTCTTGTTTTGTCCACGTCATAATGTAGGGTTGCGATGCTTCAATACTTTTGGATCCGACCC
T
GTTGACACCTAGATTTTGACGGTCCGTTTAGTCATTTATCGTATTAAAATTAGGGTTTAATCAATAATTAATTAATTGCATAGCATTTAGTTGTAGGTGCATTTATTTTTTATTTGCAT
TTACTGGATCGGTGGTGGATGGGTTGAATTGGTGGTTTTGAATTTTAAATTAATAGGCCAGGCTAGGTCCATGAAAGGATAAAATTAACCCAAGCCCGTCGTTGTTGTTTAATTGATTAT
CTTGTGAAAAATTAAGATTTGATGCGATATTATGATGATTTTTGGAAATTTAAAAATCGCACTGTAATCTTAAAGTTGGGAATATTAAGGAGGATAAGGAATATTCTAAAATATTTTGTT
GCGGATGGATATCTCGAAAAATTTTAGAATTGGATAATGGAGTTTTATCTAGAATGAATTATTTGGAAAATCTTCACAAAAAATTCCAGTTTATCTTCAATCGCTGAGTCAGCATATAAA
ATCTTCAATGGTCGAGTGAGTCAGCTTTGAGGATTTTAACAGATGATTTTAGATTTTGGAACCTCTTTTTGGTTGAGCACATCTCGTATTTTCGAAGGTAATCCTCAACGATCGGGTTGT
TATGCAAATATTCGTAGGTAGGGTTTCCACTCTATAAATATGGGGGTTTTTCTCTTCGGGGAAGGGGGGCTTCTCTCTCGAGTTTTAGGTTAAAAAATTCCACACGAGAAAGAAAAGAAA
AGCTTCGGGTTTTCTCCGTTCGTTCCTTTCCTTTGAGAAAAAAGAAAAGTTTTTTTGGAAAAGAAAGGGAAAAGTCAACAGCAAAAAGAAGCTTTTTCTTCTGAGGGAGTGGGCGACAAA
GAGCAGAAGGGAGAAGTGACGTGAGAGCAGAGAGAGAGAAAGGAAAGAAGAGGAAAAAACAAAGCATTCACTGTTCGTCTTCTACCTCTGTCGGCGCCGACCTTCGAGCAGCACCAGCAC
CGCCGACGAAGCCACAGCCGCGACCCGCCTCCTCACGACGACCCGAAGCCCCACCGGAGACCACACCGCTGGTCTGCTGCCTCGCCGGACGCCGCGCCGATCCCTGCCGCCGCGACCTGC
CTCCGCCCGACGCTCAGCAAATCTGCTCCGACGCCCAGCAAATCCCCCTCCGCCTCTGCTCCACCAGCCCGACGAAGTTGTTTCTGCGCCGATCCGCGACCCCCGACGCTGCTCCTGGTC
CGCTCGTCGCCGGTCCGCCTGCCACCGTCCTTGACGCTCGCCCGCTGTCGTGCCGCTACCTGTCACCGCACTTCCGTCCGCGAACGCCCTCGCCACACCAGCGCCGTCGCAGCAGCTCAC
CCGGTTGGTTCTCTCACTGAACGCCGCGCCCAACAGCCCGATCCAAACNNNNNNNNNNNNNNNNNNNNAGCGAAAAGCTCGCCGTCCCGAATAACAATTCGGCTAGAGGGTTCGAAGTGA
TCGATCAAATTAAGGCGGAGGTCGACAAAGCTTGCGGATACTCACTTGTATCATGTGCCGACATCTTGGCCGTCGCAGCCCGTGACTCGGTAGTTGCG
GTATGTCTTATCTTAATGCTAC
ATATGATGCGATGCCTTCATTTAAGCAAAACTACAGTGCAGACAAATAGAAGAGAGAGTCTCCCGCTAATTGAACACGCTAGGCGTAGAATCATATGCACATACATAATCTTTCGATTAT
CTAAGCAAAGCTGAATTTGAACTTAAAAGGTTGACTGAAATATTTCAGCTGGGAGGGCCTTCATGGGAAGTACAACTTGGAAGGAGGGACTCGACCACGGCGAGCAGGACAACCGCCAAC
TCCGACATTCCCGCGCCGAACATGGACTTGCCTGCACTGATCAACACGTTCCAAAAGCAAGGTCTCGACACTCGGGACTTGGTCGCGCTGAGCGGTGCTCACACAATCGGGTTCGCTCAA
TGTTTCACTTTCAGAAACCGCACATACAACGACGACAACATCGCCACCAGTTTTGCCAGGAGCCTCCGGTCTTTGTGCCCGCGTACTGGAGAGGACGGGAACCTCGCTGGTTTGGATCCT
TCGCCGGCTCAATTCGATGCATTGTACTTCCATAATCTGCTGGCGCAGAAGGGGCTTCTTCACTCTGATCAGGCGCTTTACAGTGGCGGGTCAACGGATGAGCTGGTGAAAACTTACAGT
GATGATGCGGAGGCCTTTTGGGATGATTTTGCAAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATCGGAAACCAGGGCCAGATTCGCTCAAATTGCCGAAGGTTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTAAATAGCCTCAGCCTCGTCCAAGCACTTCTCTTCTTGTCTCTCTCGACCTCGGCTTTCTCGACGCGGCCCTACAAGGAAGGCCTCACGCCATACTTCTACGACCACGTTTGC
CCTCAAGCCTTGCCCGCCATCAAACGCGTTGTCGAGGCAGCGGTGCAACAGGAGCGACGCATGGGCGCTTCGTTACTCCGTTTGCACTTCCACGATTGTTTCGTTAAC
GGTTGCGATGCT
TCAATACTTTTGGATCCGACCCT
CGAAAAGCTCGCCGTCCCGAATAACAATTCGGCTAGAGGGTTCGAAGTGATCGATCAAATTAAGGCGGAGGTCGACAAAGCTTGCGGATACTCACTT
GTATCATGTGCCGACATCTTGGCCGTCGCAGCCCGTGACTCGGTAGTTGCG
CTGGGAGGGCCTTCATGGGAAGTACAACTTGGAAGGAGGGACTCGACCACGGCGAGCAGGACAACCGCC
AACTCCGACATTCCCGCGCCGAACATGGACTTGCCTGCACTGATCAACACGTTCCAAAAGCAAGGTCTCGACACTCGGGACTTGGTCGCGCTGAGCGGTGCTCACACAATCGGGTTCGCT
CAATGTTTCACTTTCAGAAACCGCACATACAACGACGACAACATCGCCACCAGTTTTGCCAGGAGCCTCCGGTCTTTGTGCCCGCGTACTGGAGAGGACGGGAACCTCGCTGGTTTGGAT
CCTTCGCCGGCTCAATTCGATGCATTGTACTTCCATAATCTGCTGGCGCAGAAGGGGCTTCTTCACTCTGATCAGGCGCTTTACAGTGGCGGGTCAACGGATGAGCTGGTGAAAACTTAC
AGTGATGATGCGGAGGCCTTTTGGGATGATTTTGCAAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATCGGAAACCAGGGCCAGATTCGCTCAAATTGCCGAAGGTTGAACTGA

Retrieve as FASTA