Entry information : EcamPrx54 (EcS742163.10)
Entry ID 10349
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status partial
Reviewer Li
Last annotation changes 2013-05-23 (Li)
Peroxidase information: EcamPrx54 (EcS742163.10)
Name (synonym) EcamPrx54 (EcS742163.10)
Class Class III peroxidase     [Orthogroup: Prx047]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx54
start..stop
S start..stop
EguPrx51 554 0 1..271 1..271
EgrPrx53 554 0 1..271 1..271
EglPrx53 552 0 1..271 1..271
EgrPrx54 551 0 1..271 1..271
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 361..552 192 N° 3 679..844 166 N° 4 2253..2479 227
join(1..228,361..552,679..844,2253..2479)


exon

Literature and cross-references EcamPrx54 (EcS742163.10)
Protein sequence: EcamPrx54 (EcS742163.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   271 (242)
PWM (Da):   %s   29263.78 (26271.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.38 (5.91) Peptide Signal:   %s   cut: 30 range:30-271
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSTLSSPTVVALFAAALLFLLHPLNAELTADFYAKTCPDVSSIVQTVIHEALQYDPRITASLLRLHFHDCFVQGCDGSVLLDNSPTIKSEKDAAPNFNSARGFSVVDKIKAAIESTCPETVSCADILALAANASVYLSGGPYWTVLLGRRDSLTANQGLANVSIPSPFESYANLTSKFYVLGLDITDLVTLSGAHTFGRAHCKSFTPRLYNFTKNGGPDPTLSPWYLTALQKLCPPNFNPKVITDLDPTTPNLFDNHYYSNLQKNDG

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from kazusa. (3' end is missing)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACTGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAA
GTGAGTCCCTAC
ACTAGATCAATTCCCATTGACAATGAGTTCCAACTTGCCGCATTCTTTTTACAGTACTTTCGATCTGATTATCGAGTTATTAGTCACGTAACCTAATGCTTGAGCATGACGTGTTTAAAG

GGGTGTGATGGATCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGTTTCAGTGTGGTGGACAAGATCAAAGCGGCTATT
GAGAGCACTTGTCCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
GTATATGTCGTTTTAGTCAAAGAAACATAAAACATATTTAAAGTATAC
TTAGGATTCGTTATTGTCACTTGGCCTACACGAATTATAATTGTGTTTCTCTTGATTATCACTTTTATGAAATTGCAGTCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGAC
AGCTTGACGGCGAACCAAGGGCTAGCGAACGTATCGATCCCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTT
TCCG
GTAAAATAGAACAGTTGGACTTGCATTTTGATACGAACATGCAACTACAGATATTGATGCACAAAATAGATTAACAGAGTGAAATGTAAGATTTTTGTCACATAACTTATTGGCAC
AAACATCACATCACTTTCATTTAGCACATTTCAACTTCCTAATATGATCAAGGTCTCTTCTTCATTGAGATCAACAGACAGGCATGGGCTGTGCATGTGCATGGGCCATGCCCCGGCGAC
GCTATCTACTAGAAGGAATTTTAGTTAAGGATAAAGGGTTAATTTTTTTTATCTAAAATTGAATTTAAGTAAAGAATCGTCCTAAAACATGAGATCGACTAAAGTGCATGTGTTGTGCCT
AGGCTGTACCTGGGTTGTGCATGGGCTATGCACATTTACTAGAATGAATTTTGGCTGAGGATTAATGATTTATTTTTACCAAAAATTGAAAAAGTAAAGGATTGCCTATGACTTGAGATC
GACTGACGTGCGTGCGTTGTGCCTAGACCATGCGATGTTGTGCATGGGTATGTACATATATTAGAAGGATTTTTGGCTAAAGGATTAAGGGTTTCTTTCAATCTAATATTGAATAAGTAA
AGGATTGCCTTCGACTTAATTTCAGGAGCAGTTGTGTATCATCACTACTCTCAAAAAGATAGATTATTTATAAAAAAAAATTAATTATTTTTTATTAAATAAAATAGTAATAGAAAATAT
TTATTGGGGGGTAGGTATTATATAAATTAAATGGGCCAAGCAGGAATTTTAGGATGGATCCACGCAAGGGGATTTTAACTTTAATTTTCAGTTCAATCAAACTAACCCTATGTGAATTAC
CATTTAATTCAAATGGATCTAAATCAAGCCCGTGTCAGCAACTCTCAAGTCTTATCTAGTATAACTTCTTATATCAAGATGAAGAAGTGGTCAACAATGACACTTCATCATTCAATTCAT
GATGAGGTTCATAGCGTTGAAACCATCGAATTAATGTAATATTTTCTTTGTTGTGATTTGTTTTCAATCAAACTAGTGTACTTTTATGTGTAATTTTTTTTATTACAAATTTGAAAAATA
TATTCGTGTTCAATGGGTAATTTTATATTCCTAATATCATTACAAGAGTATAAATATCAGGGGAGGATGCTATCAAAATTTGCAAGCCCCTCATATACTTGTATGAGAAATGCCAAGTAT
ATTGAGGTCATTTGATAGAATCAATAAATTAAGTGATGTCACAGATCATTATTTTTTATTTATATTTTTACCAACAAGTTTGTTGCATATGTTTAGTATACAAATTCTATTAAGCATTCC
TAGTATTGGTCTATTTATCCACCTTCACAATTGAGCATCTGCAGATATTTTGTTCTCTTAGCTAATTATTCGTGCATATGATAATAAAACAGGAGCTCACACCTTTGGACGTGCACATTG
CAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGCGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACTGCTCTCCAGAAACTTTGCCCTCCAAACTTCAATCCTAAAGT
CATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACTGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAA
GGGTGTGATGGA
TCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGTTTCAGTGTGGTGGACAAGATCAAAGCGGCTATTGAGAGCACTTGT
CCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
TCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACAGCTTGACGGCGAACCAA
GGGCTAGCGAACGTATCGATCCCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTTTCCG
GAGCTCACACCTTT
GGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGCGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACTGCTCTCCAGAAACTTTGCCCTCCAAAC
TTCAATCCTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTT

Retrieve as FASTA