Entry information : EcamPrx66-2 (EcS539609.10)
Entry ID 10352
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status partial
Reviewer Li
Last annotation changes 2013-05-23 (Li)
Peroxidase information: EcamPrx66-2 (EcS539609.10)
Name (synonym) EcamPrx66-2 (EcS539609.10)
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx66-2
start..stop
S start..stop
EgrPrx65 207 1e-68 1..102 36..137
EgrPrx64 198 2e-65 1..102 36..137
EgrPrx66 196 1e-64 1..102 36..137
EglPrx66 196 2e-64 1..102 36..137
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3..116 114 N° 2 604..795 192  
join(3..116,604..795)


exon

Literature and cross-references EcamPrx66-2 (EcS539609.10)
Protein sequence: EcamPrx66-2 (EcS539609.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   102
PWM (Da):   %s   10743.48  
PI (pH):   %s   8.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
SCPNVLSTVKSVVRSAVSKERRMGASLLRLFFHDCFVNGCDGSILLDDTSSFQGEKTAGPNNKSLRGYNVIDRIKSKVESACPGVVSCADIVAIAARESVVL

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from kazusa. (PS)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGTTGTCCCAATGTTTTGAGCACGGTGAAATCTGTTGTCCGGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTCCTTCGCCTCTTCTTTCATGATTGCTTCGTCAATGTAATC
TTTCCTTCTTCCCTCCCTTTTTCCGAAATTTCTTCCTGTTCCTTACATATACTCCCCTGCCGCAACCATTTTTACCCTTAAAACCCGAGCCTTATGTCGTAAACGGGGCGAAAGAGTACG
CATAATAATTCCATTATATAGGCTGTCTATGACCATTTCTAAGAATACACTGGCTTCCTTTCTTTTTGAATATATAGACAAAAAAAAGTCAATTTGAATTTCAATACTCTCTTCCATCGA
AAATATCATGACAACATTCATGTGGACTAGTCTCTACATGAAGAATTCTTTTAAGTTAATTAGAAAATTAATAGGAAAGCATCACCGACCCTTCAATATTTATTATTTGTGAACTTCTCA
CACTAAGTGGATCGTCGATGAGTCAGTCCTGTTCAAAGACATGAGTGGCTTCCTTTTTTTTTTTTGGTCATAAAAGACATGCATGGCTTGACATGGTTAGTTTTGTACCAACCAAAAATA
GGGGTGCGATGGCTCGATACTCCTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATCGACCGGATCAAGTCCAAGGT
GGAGTCCGCCTGTCCAGGTGTGGTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGAATCGGTTGTCCTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGTTGTCCCAATGTTTTGAGCACGGTGAAATCTGTTGTCCGGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTCCTTCGCCTCTTCTTTCATGATTGCTTCGTCAATGGGTGC
GATGGCTCGATACTCCTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATCGACCGGATCAAGTCCAAGGTGGAGTCC
GCCTGTCCAGGTGTGGTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGAATCGGTTGTCCTA

Retrieve as FASTA