Entry information : EcamPrx151 ( EcC007176.10)
Entry ID 10354
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-18 (Christophe Dunand)
Peroxidase information: EcamPrx151 ( EcC007176.10)
Name (synonym) EcamPrx151 ( EcC007176.10)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx151
start..stop
S start..stop
EgrPrx151 642 0 9..323 1..315
EguPrx153 637 0 9..323 1..315
EgrPrx154 637 0 9..323 1..315
EgrPrx153 635 0 9..323 1..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..204 204 N° 2 499..1263 765  
join(1..204,499..1263)


exon

Literature and cross-references EcamPrx151 ( EcC007176.10)
Protein sequence: EcamPrx151 ( EcC007176.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (302)
PWM (Da):   %s   34794.34 (32404.2)  
PI (pH):   %s   8.48 (8.39) Peptide Signal:   %s   cut: 22 range:22-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTYFFCAVFSFITFLNSGSATLQVGFYRSTCPSAESVVRKAVNKAVAKNPGIGAGLIRMHFHDCFVRGCDASILLDSTPGNPSEKEHPANNPSLRGFEVIDEAKAELESLCPQKVSCADILAFAARDSAYKLGSINYAVPAGRRDGLVSLKDEPSQDLPPFFFNAQQLEANFARKGLSLDEMVTLSGAHSIGVSHCSSFSDRLYSFNATHTQDPSMDTKLATQLKSKCPNNGGASDPTVPLDLVTPNRLDNKYYTNLKNRRGLLTSDQTLSNSPSTANIVRSNANNGGAWANKFAAAMVKMGSIDVLTGNEGEIRRKCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1). Correct prediction from kazusa. Close to EcS579407.10 and EcC038510.10 (Removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACCTATTTCTTCTGTGCCGTGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGCCCTTCTGCGGAGTCCGTCGTCCGG
AAAGCTGTGAACAAAGCGGTGGCCAAGAACCCTGGCATTGGTGCTGGGCTTATTAGAATGCACTTCCATGATTGCTTTGTTCGG
GTATGCAAGAACTTCTTTACACATTTCAGAAGTAGT
GGTTATAATCTCGTTTGCGGAAAAATAGTAATGCAAGGAAAACCCTTTCTTTTAAGCAAAAAGCGTATGCCCATCTTTTGTCAGTACAAAAGATATCGATGAGATGGGAGTGTGGGGAGT
ACATTTCACATTCTATCACTGGTCCAGGACTTTTTTAGTTTTGTCTAACCGACCGGTCACAAAATAATCTATATTTCTTGTGCAGATGCACTTCAGCTATCCTGATAATTGCTTTGTTGT
TCTTTGATCCAATAATAGGGTTGCGATGCTTCGATCTTGCTAGATTCGACCCCAGGCAACCCATCAGAGAAGGAACATCCAGCGAACAACCCGAGCTTACGAGGTTTTGAAGTCATTGAC
GAGGCAAAGGCTGAGCTAGAGTCTCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCTTGCATTCGCAGCACGCGACAGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCG
GGTCGCCGCGATGGGCTGGTCTCACTCAAAGACGAGCCCTCCCAGGATCTTCCTCCTTTCTTCTTCAATGCGCAACAATTAGAAGCTAATTTTGCGAGAAAAGGCCTCTCTCTGGACGAG
ATGGTGACGCTATCCGGTGCACATTCCATTGGAGTCTCGCATTGCTCCTCCTTCTCGGACCGCTTGTACTCCTTCAATGCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTGGCT
ACTCAACTGAAATCTAAGTGTCCAAACAATGGAGGCGCTAGCGATCCCACTGTGCCATTGGACTTGGTCACGCCGAACAGGCTAGACAACAAGTACTACACTAATTTGAAGAACCGCCGA
GGCCTATTGACTTCTGATCAGACTCTTTCTAACAGCCCTTCGACGGCGAATATCGTGAGGAGCAATGCAAATAATGGCGGAGCATGGGCTAACAAGTTCGCAGCGGCAATGGTGAAGATG
GGATCGATTGACGTCCTCACTGGGAACGAGGGTGAGATTAGGAGGAAATGCAGGGTGGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACCTATTTCTTCTGTGCCGTGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGCCCTTCTGCGGAGTCCGTCGTCCGG
AAAGCTGTGAACAAAGCGGTGGCCAAGAACCCTGGCATTGGTGCTGGGCTTATTAGAATGCACTTCCATGATTGCTTTGTTCGG
GGTTGCGATGCTTCGATCTTGCTAGATTCGACCCCA
GGCAACCCATCAGAGAAGGAACATCCAGCGAACAACCCGAGCTTACGAGGTTTTGAAGTCATTGACGAGGCAAAGGCTGAGCTAGAGTCTCTATGCCCGCAGAAGGTCTCATGCGCTGAC
ATTCTTGCATTCGCAGCACGCGACAGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCTCACTCAAAGACGAGCCCTCCCAGGATCTTCCT
CCTTTCTTCTTCAATGCGCAACAATTAGAAGCTAATTTTGCGAGAAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCACATTCCATTGGAGTCTCGCATTGCTCCTCCTTC
TCGGACCGCTTGTACTCCTTCAATGCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTGGCTACTCAACTGAAATCTAAGTGTCCAAACAATGGAGGCGCTAGCGATCCCACTGTG
CCATTGGACTTGGTCACGCCGAACAGGCTAGACAACAAGTACTACACTAATTTGAAGAACCGCCGAGGCCTATTGACTTCTGATCAGACTCTTTCTAACAGCCCTTCGACGGCGAATATC
GTGAGGAGCAATGCAAATAATGGCGGAGCATGGGCTAACAAGTTCGCAGCGGCAATGGTGAAGATGGGATCGATTGACGTCCTCACTGGGAACGAGGGTGAGATTAGGAGGAAATGCAGG
GTGGTGAAC

Retrieve as FASTA