Entry information : EcamPrx[P]147 ( EcS568817.10)
Entry ID 10358
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Christophe Dunand
Last annotation changes 2016-03-12 (Christophe Dunand)
Peroxidase information: EcamPrx[P]147 ( EcS568817.10)
Name (synonym) EcamPrx[P]147 ( EcS568817.10)
Class Class III peroxidase     [Orthogroup: Prx161]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx[P]147
start..stop
S start..stop
EgrPrx[P]147 408 3e-146 1..209 11..219
EguPrx[P]147 402 9e-144 1..209 11..219
EglPrx[P]147 391 2e-139 1..209 22..230
EglPrx148 373 4e-132 1..209 21..229
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28..186 159 N° 2 262..453 192 N° 3 547..712 166 N° 4 860..969 110
join(28..186,262..453,547..712,860..969)


exon

Literature and cross-references EcamPrx[P]147 ( EcS568817.10)
Protein sequence: EcamPrx[P]147 ( EcS568817.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   209
PWM (Da):   %s   22409.03  
PI (pH):   %s   6.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGCSDSQLSPDFYSKTCPHVFTAVKSRVESTVKKEPRMGASLLCLFFHDCFVNGCDGWVLLDDTPTFTGEKNAASNRNSARGFEVIDDVKSVVEKVCPGIVSCADLLAITARDSIVLLGGPSWNVKLGRRDARTASQAATNSSLPSPTSNLTDLISSFENASLSTTDLVALSSSHSIGQAKCANFRARIYNEIDLDCSFGEIRRKNCP

Retrieve as FASTA  
Remarks Pseudogene sequence from genomic. Incorrect prediction from kazusa (Two ends are missing due to short contig).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTGCTCCGATTCCCAGCTTTCCCCCGATTTCTATTCAAAAACATGTCCGCACGTCTTCACCGCGGTCAAATCCCGGGTGGAATCCACTGTCAAGAAGGAACCTAGAATGGGAGCC
TCCCTCCTCTGCCTGTTTTTCCATGATTGCTTTGTGAAT
GTAAGCTACCATAAATTGACTTATCTTTCTTTCATTGTATCCTAGAAATTCATTTTGTCTTTCGTCTATTGCCAGGGCTGC
GATGGATGGGTTCTTCTCGACGACACGCCAACTTTCACTGGTGAAAAGAACGCAGCTTCAAACCGAAACTCTGCCAGAGGATTCGAGGTCATAGACGATGTCAAGTCTGTTGTGGAGAAA
GTGTGCCCTGGTATTGTTTCTTGCGCTGACTTGTTGGCCATCACCGCTCGCGACTCCATCGTCTTG
GTAAGCCCTCCCAATCCCTCCAAAAAAAATCACTACCCCATACAAGTACTACTC
ACAAATTTGCTCTAACTAAGATTGTGTTGAAATTTGCAGCTTGGAGGGCCAAGCTGGAACGTGAAACTCGGAAGAAGAGATGCAAGAACCGCGAGCCAAGCAGCTACTAACAGTAGCCTT
CCCTCTCCAACCTCAAACCTTACCGACCTCATATCTAGCTTTGAAAATGCTAGCCTCTCCACGACAGACTTGGTGGCTTTATCTA
GTATGTACACTCATAAACACAATCCCGGACGGTTG
CTGGAGTAATAATGCAAAAAGCATTTTCTTTTATTTTTTTTATTGTAAATGGAGAAAAAAAGAAAAAGAAAAAAAAAAAAGAGATACTAACTTATCATATCTGTTTTGACAGGTTCACAT
TCGATAGGGCAAGCGAAATGTGCAAATTTCAGAGCTCGGATCTACAATGAGATCGACCTGGACTGTTCCTTCGGTGAGATAAGGCGGAAGAACTGCCCAAGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTGCTCCGATTCCCAGCTTTCCCCCGATTTCTATTCAAAAACATGTCCGCACGTCTTCACCGCGGTCAAATCCCGGGTGGAATCCACTGTCAAGAAGGAACCTAGAATGGGAGCC
TCCCTCCTCTGCCTGTTTTTCCATGATTGCTTTGTGAAT
GGCTGCGATGGATGGGTTCTTCTCGACGACACGCCAACTTTCACTGGTGAAAAGAACGCAGCTTCAAACCGAAACTCTGCC
AGAGGATTCGAGGTCATAGACGATGTCAAGTCTGTTGTGGAGAAAGTGTGCCCTGGTATTGTTTCTTGCGCTGACTTGTTGGCCATCACCGCTCGCGACTCCATCGTCTTG
CTTGGAGGG
CCAAGCTGGAACGTGAAACTCGGAAGAAGAGATGCAAGAACCGCGAGCCAAGCAGCTACTAACAGTAGCCTTCCCTCTCCAACCTCAAACCTTACCGACCTCATATCTAGCTTTGAAAAT
GCTAGCCTCTCCACGACAGACTTGGTGGCTTTATCTA
GTTCACATTCGATAGGGCAAGCGAAATGTGCAAATTTCAGAGCTCGGATCTACAATGAGATCGACCTGGACTGTTCCTTCGGT
GAGATAAGGCGGAAGAACTGCCCAAGC

Retrieve as FASTA