Entry information : EcamPrx124 (EcS739682.10)
Entry ID 10373
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx124 (EcS739682.10)
Name (synonym) EcamPrx124 (EcS739682.10)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx124
start..stop
S start..stop
EgrPrx124 617 0 2..308 19..325
EglPrx124 581 0 2..292 19..309
EglPrx124 163 1e-47 233..308 310..385
EguPrx124 503 0 14..263 1..250
CsPrx09 502 0 9..308 11..310
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..24 24 N° 2 239..376 138 N° 3 648..839 192 N° 4 972..1137 166
N° 5 1230..1636 407  
join(1..24,239..376,648..839,972..1137,1230..1636)


exon

Literature and cross-references EcamPrx124 (EcS739682.10)
Protein sequence: EcamPrx124 (EcS739682.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   308
PWM (Da):   %s   33478.48  
PI (pH):   %s   5.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPLSDVLDYKFYDDSCPNLTKLVRYGVWSAMANETRMAASILRLHFHDCLVDGCEGSVLLDDTSTIKGEKNAFANRNSARGFEVIDAIKANVEKACPAMVSCADILTLAAREAVYLTGGQFYAVPLGRRDGLSSSDSAANEQLPSPSEPLENITAKFTSKGLDMKDVVVLSGAHTIGFAQCFTFKTRLFNFGGSGKPDPALDTSFLQNLQVACPNQDDSDTKLAALDTTSDKFDNYYYKNLINNSGLLQSDQALMGDNRTAAAVMYYSKYPFLFWRDFGASMVKMANIGVLTGQNGQIRKNCRAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCTTCCACTCTCTGATGTGGTTAGCTCCCAATTTGACACTCAGTTCCTACTGATCTGTGTTAGCTCTTCTTGTATAAATTGCTTGTGCTGATCCGTGATCTCTACCACTTGTCAC
TCAAACCAGTAACAAAATAGCTGTGGTTGTTTGTTGCGAAGATATGAAGTTCAGCTCTAAAGTTTCATGGTTTCCATGCTTCTGCATCCTGTTCTGCAGCCTTTTTGTGTCCTCTCAGCT
CGATTATAAGTTCTACGACGACTCTTGTCCCAATCTGACGAAACTTGTCCGGTATGGCGTTTGGTCAGCTATGGCGAACGAGACCAGGATGGCTGCGTCTATCTTGCGCCTACATTTCCA
CGATTGTCTTGTCGAT
GTAATTGAAACTCTTCGATTGCTTCTCCTGGGTGGTGTAAATTGGCACATCTGAAACTTTCTTTTTTTTGGTAACTTGGACTAAAGTTTAAATTGGTTTATGTG
TGACAAACATCATAAGATTTAGACAGCTACATTTTTGGAAGCCTCGATTGATCGTGCTGAAAGATTAAAAAATGCTTTAAGCTATACTGTTACTGAATAAATTTTCTTTTACTGATGAAC
CAAATTGCAAACTCTCCTGTAAACATTTTTCTTTTTTGCATGGTCAGGGATGTGAGGGCTCGGTCCTGCTAGATGATACAAGCACAATAAAGGGAGAGAAGAATGCATTTGCCAATCGTA
ATTCAGCGAGAGGTTTCGAGGTCATTGATGCCATCAAGGCGAATGTGGAAAAAGCATGCCCGGCCATGGTTTCTTGTGCTGATATTCTCACTCTAGCCGCAAGAGAAGCTGTTTATTTG
G
TAATCAACTCTGCTGTTGTGTATCCGCTCTTCATGAGAACAGCTAGCTTCGCCTTTCGACCAGCTCATTCTGACTCTGTGTCACTAAACGAACGTGCATTTGCACTTTCTTTTTTCTTTT
ATATCTTTTAGACAGGAGGGCAATTTTATGCAGTGCCCTTAGGGCGCCGAGACGGTTTAAGTTCGAGCGATAGCGCCGCCAACGAGCAGCTGCCTTCACCCTCAGAGCCCCTGGAAAACA
TCACTGCCAAGTTCACCTCTAAGGGCCTTGACATGAAGGATGTGGTAGTGCTTTCAG
GTTCATATCCATCTCTACAACTACCAACTAATATTATTTATCCTAGGTAAGATGATAAGACCA
ATTTGCGCTCTTTATTTCGGGATGCGCAGGTGCGCATACAATAGGCTTTGCTCAATGCTTCACGTTCAAGACGAGGCTCTTCAACTTCGGCGGCTCCGGCAAGCCTGACCCAGCACTAGA
CACATCGTTTCTGCAAAATCTACAAGTAGCGTGCCCCAACCAGGACGACTCTGACACCAAGTTGGCTGCTTTAGACACAACATCCGATAAATTCGACAACTATTACTACAAGAACCTCAT
CAACAACTCCGGGTTGCTCCAGTCGGACCAAGCCCTCATGGGCGACAACAGAACTGCCGCGGCGGTCATGTACTATAGCAAGTACCCCTTTCTGTTTTGGAGGGATTTCGGAGCGTCGAT
GGTAAAAATGGCCAATATCGGCGTGCTCACCGGACAGAATGGTCAGATTAGGAAGAACTGTAGGGCGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCTTCCACTCTCTGATGTGCTCGATTATAAGTTCTACGACGACTCTTGTCCCAATCTGACGAAACTTGTCCGGTATGGCGTTTGGTCAGCTATGGCGAACGAGACCAGGATGGCT
GCGTCTATCTTGCGCCTACATTTCCACGATTGTCTTGTCGAT
GGATGTGAGGGCTCGGTCCTGCTAGATGATACAAGCACAATAAAGGGAGAGAAGAATGCATTTGCCAATCGTAATTCA
GCGAGAGGTTTCGAGGTCATTGATGCCATCAAGGCGAATGTGGAAAAAGCATGCCCGGCCATGGTTTCTTGTGCTGATATTCTCACTCTAGCCGCAAGAGAAGCTGTTTATTTG
ACAGGA
GGGCAATTTTATGCAGTGCCCTTAGGGCGCCGAGACGGTTTAAGTTCGAGCGATAGCGCCGCCAACGAGCAGCTGCCTTCACCCTCAGAGCCCCTGGAAAACATCACTGCCAAGTTCACC
TCTAAGGGCCTTGACATGAAGGATGTGGTAGTGCTTTCAG
GTGCGCATACAATAGGCTTTGCTCAATGCTTCACGTTCAAGACGAGGCTCTTCAACTTCGGCGGCTCCGGCAAGCCTGAC
CCAGCACTAGACACATCGTTTCTGCAAAATCTACAAGTAGCGTGCCCCAACCAGGACGACTCTGACACCAAGTTGGCTGCTTTAGACACAACATCCGATAAATTCGACAACTATTACTAC
AAGAACCTCATCAACAACTCCGGGTTGCTCCAGTCGGACCAAGCCCTCATGGGCGACAACAGAACTGCCGCGGCGGTCATGTACTATAGCAAGTACCCCTTTCTGTTTTGGAGGGATTTC
GGAGCGTCGATGGTAAAAATGGCCAATATCGGCGTGCTCACCGGACAGAATGGTCAGATTAGGAAGAACTGTAGGGCGGTGAACTAG

Retrieve as FASTA