Entry information : EcamPrx23 (EcC009480.10)
Entry ID 10383
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx23 (EcC009480.10)
Name (synonym) EcamPrx23 (EcC009480.10)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx23
start..stop
S start..stop
EgrPrx23 640 0 1..319 1..319
EguPrx23 636 0 1..319 1..319
EcamPrx21 598 0 1..319 1..319
EcamPrx22 595 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..216 216 N° 2 1931..2122 192 N° 3 2245..2410 166 N° 4 2518..2903 386
join(1..216,1931..2122,2245..2410,2518..2903)


exon

Literature and cross-references EcamPrx23 (EcC009480.10)
Protein sequence: EcamPrx23 (EcC009480.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33420.41 (30768.0) Transmb domain:   %s   i12-34o
PI (pH):   %s   7.7 (7.70) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWESSSVRTAFLLLLSFLLGTASAQLSSTFYSTSCPSALSTIKSGVSSAVKSEARMGASLLRLHFHDCFVNGCDASVLLDDTANFTGEKNATPNANSLRGFDVIDTIKSQLESACPGVVSCADLLTVAARDSVVALGGPSWTVPLGRRDSTTASQSAANSNIPAPTLNLSGLITAFSNKGFTTKEMVALSGSHTIGQARCTTFRARLYNENNINTTFSTSLKANCPSSGGDNNLSPLDTTSPTSFDNAYFKNLQIQEGLLHSDQQLFSGGSTDAQVNAYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGGAGAGCTCTTCGGTCAGAACCGCCTTTTTATTGTTGCTGTCTTTCCTACTGGGAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTTAAT
GCAAGTCCCTCTGCCCGGAGTCTC
TCCTCTCTTTCCGATTGATTGCTACCTTTGTTTCTCTTCTGTCATTCAAGCTGCATGCAAGCGTACATGCATGATGCATCTTTGTGCTTTTGTGCATGTGAAACGTTCCAACCGACCTCA
TAGTAAAAAAGAATGATTAGATTTCGCTTCTACGCAAGTTACTTACTCTCTTTTTCACTAACCAAACAATAGGTAGGAAGTACACATATTGCATTAGTCGAGTCTGACCGACCCTTTTTG
TGCCATGCATTTTTGTGAGTTTATTATTATTATAATAATAGGCTGTGTTTATTGAAGTCGTTTAAAATTAGAGCTATGTTTTCATTCAAACAGCAATAAAAAGCATGGCCCTTAGAATAA
AAGCACTTCTTTTTGGTGATTCAAAGAAAAAATTTTCATGAGTAATTCTAGTATACACCGCTAGTGTAAAAATCTCATTCCATAAGTGGTCTTATCCACTAAATATTTTGGTGGCCGGGG
AGAGATTTGGTAATTAGAATCCTCAAATCAAGATGGACAAGACTGTTTTTGTGCGTGCTCTAATTTTTTTTTTCATTTATTAAATTGATAATGTATTCTATAACTTCATTACAAAAGCCA
TGCAGGCGAGCGTATTTTATGGCGAGTATGTTGTGGTTGTGGATAAGACGTGTGTATGTATCATTAGCTACATGATTTTAATTCGATGAATTAGATCACGCAAAAGTCCCAAACGTTGGA
GATGGCCAAAAGAGAGAGCGACAGCCTTGCTTTTATGACGGTGGTTGACTTTACGCGTTTATCATGTTTGGCAAATCAATCAGTCGTTTTCAATAGGTTTTGGTCATATTTTGATCACCG
TCACTTTGGTTGCCATACTTTTCTACATTAAAAATGATATTTTGCCATAAAATATCTTTTTTTAATGAAATTTGTTAGTCCAATGGTGTTCTAAAAATTGTATTAGATCTTTTGAACAAA
ACAAAAAGTGCCTTGTGCATGGCCTCACTACTTTGCTTCCAACACAAATTTAGAGTGTCAATCTAAATTAGCTAATCAATTTGAAGTACCTTCATTATTATCCACTTCGTGTTCTTTGTG
CATAATTCAAGAGTTGTCCATATCCTAACGGGCCTTTCTCCATCGAACATGTCGTCTCTATTTTGAGCTTGATATTTAAAGCCTGATCCTTTTTTTACTAACAAATGTGACATGTTTATA
ACTTTCTCGATTAGATGCATTTCTCTTTTTCCTGTATGGATTGGAGATTGTCTAGATCTTCGAGGTCATTCAAGTAGACATAATTCAGGTTAATTTTAGTAAATCAAAAAGTCGGTGACT
CCCCTCCGTTAAATATTAAAGGACACGGCATGGTGCTGACCAAAAGCCTTGATTTAGAGAACACTTGAGAGCACAATCATTTTGTTTCTAGTCCGACAATTATTGGATGCATTGTTCCTA
GATAGACAACACAAATTAAAGTCAAAAGGCATGAGAAAGAGTGTCATTTCCGTCCAAACTGGTGTCTGTGGGCGTTCATAACGGGGGACAAAAAGGGGGAATATGATAAGGGAAATTAAT
CAGTGTTCATACTTTATGTTGAGGAAAAAGTTACAGCACTTGTTCTGTTTATATTTTGACCGTCGAATCTAATGAAGGCAGTAAGATTGATTTGACTGATTAACGATGTGTGGCAAAAAA
CATAATATAGGGATGCGACGCATCTGTTTTGTTGGACGACACCGCGAACTTCACTGGGGAGAAGAATGCTACCCCAAATGCCAATTCCTTACGGGGATTTGATGTGATTGACACGATCAA
GTCCCAATTGGAGAGCGCATGCCCCGGTGTTGTGTCCTGCGCTGATCTCTTGACTGTGGCTGCCCGAGATTCCGTTGTCGCT
GTAAGCGCACACTTTCTTCTTAATTCTAGTGATCAATT
GTGATGAGAAAAAATCACTCGTTATGATCTCGATGCTGCATCAATACTAACACGTGTGGATTTGTTTAACTATTTAATTCTTAGTTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAAGA
AGAGACTCAACTACTGCAAGCCAAAGTGCTGCTAATAGCAACATCCCTGCCCCGACTTTGAACCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCACCAAAGAAATGGTG
GCACTCTCAG
GTCATTGTTTTTCCTTTTTTGTGGCACCTGTTAATAACGAATTTACAATAATGCTTGATCGATATACTAAGATTAATATTAAGAAGTTGTTCGATTGTTGTTAATAGGGT
CGCACACGATAGGTCAAGCCCGATGCACAACTTTCCGGGCCCGTCTTTACAACGAGAACAACATCAACACCACGTTCTCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGTGACA
ACAATCTCTCTCCTCTAGACACCACGAGCCCGACGTCCTTTGACAATGCCTACTTTAAGAACTTGCAAATCCAAGAAGGTCTTCTTCACTCGGACCAGCAATTGTTTAGTGGTGGTTCCA
CGGACGCTCAGGTGAACGCTTATAGCAGCAATTCAGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGTGGTCAGATTAGGA
AGAACTGCAGGAAAGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGGAGAGCTCTTCGGTCAGAACCGCCTTTTTATTGTTGCTGTCTTTCCTACTGGGAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTTAAT
GGATGCGACGCATCTGTTTTGTTG
GACGACACCGCGAACTTCACTGGGGAGAAGAATGCTACCCCAAATGCCAATTCCTTACGGGGATTTGATGTGATTGACACGATCAAGTCCCAATTGGAGAGCGCATGCCCCGGTGTTGTG
TCCTGCGCTGATCTCTTGACTGTGGCTGCCCGAGATTCCGTTGTCGCT
TTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAAGAAGAGACTCAACTACTGCAAGCCAAAGTGCTGCTAAT
AGCAACATCCCTGCCCCGACTTTGAACCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCACCAAAGAAATGGTGGCACTCTCAG
GGTCGCACACGATAGGTCAAGCCCGA
TGCACAACTTTCCGGGCCCGTCTTTACAACGAGAACAACATCAACACCACGTTCTCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGTGACAACAATCTCTCTCCTCTAGACACC
ACGAGCCCGACGTCCTTTGACAATGCCTACTTTAAGAACTTGCAAATCCAAGAAGGTCTTCTTCACTCGGACCAGCAATTGTTTAGTGGTGGTTCCACGGACGCTCAGGTGAACGCTTAT
AGCAGCAATTCAGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGTGGTCAGATTAGGAAGAACTGCAGGAAAGTCAACTAA

Retrieve as FASTA