Entry information : EcamPrx53 ( EcC011827.10)
Entry ID 10387
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2013-10-30 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-10 (Christophe Dunand)
Peroxidase information: EcamPrx53 ( EcC011827.10)
Name (synonym) EcamPrx53 ( EcC011827.10)
Class Class III peroxidase    [Orthogroup: Prx057]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx53
start..stop
S start..stop
EguPrx51 674 0 1..334 1..334
EgrPrx53 674 0 1..334 1..334
EglPrx53 673 0 1..334 1..334
EgrPrx54 642 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 361..552 192 N° 3 679..844 166 N° 4 3252..3670 419
join(1..228,361..552,679..844,3252..3670)


exon

Literature and cross-references EcamPrx53 ( EcC011827.10)
Protein sequence: EcamPrx53 ( EcC011827.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (305)
PWM (Da):   %s   36096.18 (33103.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.39 (5.93) Peptide Signal:   %s   cut: 30 range:30-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSTISSPTVVALFAAALLFLLHPLNAELTADFYAKTCPDVSSIVQTVIHEALQYDPRITASLLRLHFHDCFVQGCDGSVLLDNSPTIKSEKDAAPNFNSARGFGVVDKIKAAIESTCPETVSCADILALAANASVYLSGGPYWTVLLGRRDSLTANQGLANTSIPSPFESYANLTSKFFVLGLDITDLVTLSGAHTFGRAHCKSFTPRLYNFTKNGGPDPTLSLWYLTALQKLCPPNFNTKVITDLDPTTPNLFDNHYYSNLQKNDGLFETDQELYSTAGAATVPIVNSFSADQSAFFKSFTRSIVNMGNISPLTGSNGEIRFNCRKVNKS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTATTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAA
GTGAGTCCCTAC
ACTAGATCAATTCTCATTGACAATGAGTTCCAACTTACCGCATTCTTTTTACGGTACTTTCGATCTGATTATTGAGTTATTAGTCACGTAACCTAATGCTTGAGCATGACGTGTTTAAAG

GGGTGTGATGGATCGGTATTGCTGGACAACAGCCCAACCATAAAGAGCGAGAAAGATGCCGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATT
GAGAGCACTTGTCCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
GTATATGTTGTTTTAGTCAAAGAAACATAAAACATATTTAAAGTATAC
TTAGGATTCGTTATTGTCACTTGGCCTACACGAATTATAATTGTGTTTCTCTTGATTATCACTTTTATGAAATTGCAGTCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGAC
AGCTTGACGGCGAACCAAGGGCTAGCGAACACATCGATACCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTTTGTTTTGGGCTTGGACATCACCGACCTTGTCACACTT
TCCG
GTAAAATAGAACAGTTGGGACTTGCATTTTGATACGAACATGCAACTACAGATATTGATGCACAAAATAGATTAACAGAGTGAAATGTCGGATTTTTGTCACATAACTTATCGGCA
CAAACATCGCATCACTTTCATTTAGCACATTTCAACTTCCTAATATGATTAAGGTCTCTTCTTCATTGAGATCAACAGACAGGCATGGGTTGTGCATGTGCATGGGCCATGCCCCGGCGA
TGCTATCTACTAGAAGGAATTTTAGTCAAGGATTAAGGGTTAGATTTTTTTTTTCTCCTAAATTGAATTTAAGTAAAGAATTGTCTTAAAACATGTGAACGACTAAAGTGCACGTGTTGT
GCCTAGGCTGTACCTAGGTCGTGCATGGGCTATGCACATTTACTAGAAGGAATTTTGACTGAGGATTAATGATTTCTTTTTACCAAAAATTGAAAAAGTAAAGAATTGCCCTTGACTTGA
GATCGACTGACGTGCATGCGTTGTGCCTGGGCCATGCCATGTTGTGCATGGGTATGTACATATATTAGAAGGAATTTTAGCTAAAGGATTAAGGGTTTCTTTTCAATCTAAAATTGAATA
AGTAAAGGATTGCCCTTGACTTAATTTCAGGAGCAGTTGTGTATCATCACTACTCTAAAAAAGATAGATTATTTAAAAACGGCATGACCGAGACTTATCTCCTCGGTAAATTCAAAAATG
AGAGGAAGCCGATGATACGTAATTTCATTAAATTAGAAATTATGGGTTCATACATTTGCAGGTCCATAATTTGCTAGTCCTTGATAAAAATGGTAATTCAATAGCGTTAGTTTGATTGAA
CTAATGAGTAAAGTTAAAATCCCCTTGCGTGAATCCTACTTATCTTTAATTCAAATGGATCCAAATCAAGCCCGCATCAGCAACTCTTTAAGTCTTATCTAGTATAACTTCTGCCATCAA
GATGAAGAAGTGGTCAACGATGACACTTCATCGTTCAATTCATAACGAGGTTCATAGCGCTGAAACCATCGAATTAATGTAAAATGTTTTTTTTTTGTGATTTGTTTTCAATTAAACTAG
TGTACTTTTATGTGTAATATTTTTATTACAAATTTGAAAAATATATTCGCGTTTTATTCATTTTTTCAATGGATAATTTTATATTCATGATATCATTACAAGAGTATAAATATAAGGGGA
GGATGCTATCAAAATTTGCAAGTCCCTCATATACTTGGGGAAAAGTGCGAAAAAAGTCCTAAACCTTTTGCTTTTGTGCCAATTTAGTCCTAAACCTTTTTTCGGTGCCAATTCAGTCCT
AAACCTTTTTAAGTCGTGCCAATTCAGTCATTTCCAGCAATTTTGACCAGATTTTGCTGACTGGACGCCGGCCGGCTGACGTGGCCTGATCGGCGCTGACGTGGACAACTTTTAATAATA
TTTTAATATATTTTTTTTAAATATTTTAATATTTTTTATTTTTTAAATATTTTTTTATTTTTTTATTATTTTTATTTTTTTTTAGTTTTGTCTTTTTCCTCCTGCCGGTCGCCGGGGTTC
GGCGACCGGCCAGAGGCGATCGCCGGCGAGGGCGAGGCCGACCTCGCCGGATCTGGCGAGGTCGAGCCTCGCCGGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCCATGGCCGGCGAGACTCGACCTCGCCAGATCCGGCGAGGTCGGCCTCGCCCTCGCCGGCGGTCGCTTCTGGCCGGTCGCCGGACCTCGGCGACCGGCTGGAGGAAAAAGAAAAAA
AGAAAAAAATATTAAAAGTATTTAAAAAATTACAAAATTGTTAAAAAATTATTAAAAGTTGTCCGCATCAGCGCCGATCATGCCACGTCAGCCGACCGGCGTCCAGTCAGCAAAATCCGG
TGAAAATTGGCTGGAAAGGACTGAATTGGCACAACTTAAAAAGGTTTAGGACTGAATCGGCACCAAAAAAAGGTTTAGGACTAAATTGGCACAAAGGCAAAAGGTTTAGGACTTTTTTGG
CACTTTTCCCCATATACTTGTATGAGAAATGCCAAGTATACTGAGGTCATTTGATAGAATCAATAAATTAAGTGATGTCACATATCATTATTATTTATTTATATTTTTACTAACGAGTTT
GTTGCATATGTGTAGTATACAAATTCTATTAAGCATTCCTAGTATTGGTCTATTTATCCACCTTCACAATTGAGCATCTGCAGATATTTTGTTCTCTTAGCTAATTATTCGTGCATATGA
TAATAACACAGGAGCTCACACTTTTGGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGTGGCCCCGATCCCACCCTAAGCCTGTGGTACTTGACGGC
TCTCCAGAAACTTTGCCCTCCAAATTTCAATACTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTT
TGAGACTGATCAAGAGCTGTACTCGACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGG
AAACATCAGTCCTCTCACCGGAAGTAACGGGGAGATCAGGTTCAATTGCAGGAAGGTCAATAAGAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGTTCTTCTACTATTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGC
CCGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAA
GGGTGTGATGGA
TCGGTATTGCTGGACAACAGCCCAACCATAAAGAGCGAGAAAGATGCCGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTGAGAGCACTTGT
CCTGAGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
TCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACAGCTTGACGGCGAACCAA
GGGCTAGCGAACACATCGATACCCTCCCCTTTTGAGAGCTATGCCAACCTCACTTCCAAGTTCTTTGTTTTGGGCTTGGACATCACCGACCTTGTCACACTTTCCG
GAGCTCACACTTTT
GGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGTGGCCCCGATCCCACCCTAAGCCTGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAAT
TTCAATACTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTGAGACTGATCAAGAGCTGTACTCG
ACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATCAGTCCTCTCACCGGAAGT
AACGGGGAGATCAGGTTCAATTGCAGGAAGGTCAATAAGAGTTAA

Retrieve as FASTA