Entry information : OsPrx29
Entry ID 1039
Creation 2005-07-20 (Filippo Passardi)
Last sequence changes 2005-07-20 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx29
Name OsPrx29
Class Class III peroxidase     [Orthogroup: Prx018]*
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx29
start..stop
S start..stop
SiPrx77 474 3e-170 4..319 6..319
OsPrx30 470 1e-168 1..321 1..327
HvPrx15 458 6e-164 4..319 8..321
SbPrx74 454 3e-162 1..321 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7947807..7948016 210 N° 2 7948152..7948349 198 N° 3 7948433..7948990 558  
join(7947807..7948016,7948152..7948349,7948433..7948990)


exon

Literature and cross-references OsPrx29
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q6ER49
DNA ref. GenBank:   NC_008395.1 (7947807..7948987)
Protein sequence: OsPrx29
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (298)
PWM (Da):   %s   34066.66 (31417.4)  
PI (pH):   %s   5.6 (5.63) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRTWHCWLLLVFFLLSDDASGQLSTSYYADSCPSVEKVVHATVASAIQAERRMGASLIRLFFHDCFVQGCDASILLDDVPATGFVGEKTAAPNNNSVRGYEVIDQIKANVEDVCPGVVSCADIVALAARDSTALLGGPSWAVPLGRCDSTTASRSEANSDLPGPGSNLTMLIARFGNKGLSPRDMTALSGSHTVGFSQCTNFRAHIYNDANIDPSFAALRRRACPAAAPNGDTNLAPLDVQTQNAFDNAYYGNLLVRRGLLHSDQVLFNGGSQDALVRQYAANPALFAADFAKAMVKMGNIGQPSDGEVRCDCRVVNDS*

Retrieve as FASTA  
Remarks chromosome 2. 33 ESTs. Rice blast fungus interaction, leaf library induced by M.grisea.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCAGGACTTGGCATTGCTGGTTGTTGCTCGTCTTCTTCCTCCTCTCCGACGACGCCTCCGGGCAGCTGTCGACGTCGTACTACGCAGATAGCTGCCCGTCGGTGGAGAAGGTC
GTGCACGCCACCGTGGCGAGCGCCATCCAGGCCGAGCGCCGGATGGGCGCCTCCCTCATCCGCCTCTTCTTCCACGACTGCTTCGTCCAG
GTTTAATCATCTTGTAAACTGGATTAATTT
GTTAATCACCACGTTATAATGTCTTAGGGTTCTAACGTTTGCAACTTTGCAAGGATGATTATTGATTAATCATGGTATTAATGATCGATCTGCAAACTGGTCCAGGGCTGCGACGCGTCC
ATCCTTCTGGACGACGTGCCGGCGACCGGGTTCGTCGGCGAGAAGACCGCCGCCCCGAACAACAACTCCGTGCGCGGGTACGAGGTCATCGACCAGATCAAGGCCAACGTCGAGGACGTC
TGCCCCGGCGTTGTCTCCTGCGCCGACATCGTCGCCCTCGCCGCGCGCGACAGCACCGCCCTG
GTACGTTCACCCGAGTGTTCGACGCGTGCTCGTGACATGCGTGGCGAGCTGGTGTGT
GAGCGACATTCGTCTTGTCCATGCAGCTCGGCGGGCCGAGCTGGGCGGTGCCGCTCGGCCGGTGCGACTCGACGACGGCGAGCCGCAGCGAAGCGAACAGCGACCTGCCGGGGCCGGGGA
GCAACCTCACCATGCTCATCGCGCGGTTCGGCAACAAGGGCCTAAGCCCGCGCGACATGACGGCGCTGTCGGGCTCGCACACCGTCGGCTTCTCGCAGTGCACCAACTTCCGCGCCCACA
TCTACAACGACGCCAACATCGACCCGTCGTTCGCCGCGCTGCGCCGCCGCGCGTGCCCCGCCGCGGCACCCAACGGCGACACCAACCTGGCGCCGCTCGACGTGCAGACGCAGAACGCGT
TCGACAACGCCTACTACGGCAACCTGCTGGTCCGGCGAGGCCTGCTCCACTCCGACCAGGTGCTGTTCAACGGCGGGTCGCAGGACGCGCTGGTGAGGCAGTACGCCGCCAACCCGGCGC
TGTTCGCCGCCGACTTCGCCAAGGCGATGGTGAAGATGGGGAACATCGGGCAGCCCAGCGACGGCGAGGTCAGGTGCGACTGCAGGGTCGTCAACGACAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCAGGACTTGGCATTGCTGGTTGTTGCTCGTCTTCTTCCTCCTCTCCGACGACGCCTCCGGGCAGCTGTCGACGTCGTACTACGCAGATAGCTGCCCGTCGGTGGAGAAGGTC
GTGCACGCCACCGTGGCGAGCGCCATCCAGGCCGAGCGCCGGATGGGCGCCTCCCTCATCCGCCTCTTCTTCCACGACTGCTTCGTCCAG
GGCTGCGACGCGTCCATCCTTCTGGACGAC
GTGCCGGCGACCGGGTTCGTCGGCGAGAAGACCGCCGCCCCGAACAACAACTCCGTGCGCGGGTACGAGGTCATCGACCAGATCAAGGCCAACGTCGAGGACGTCTGCCCCGGCGTTGTC
TCCTGCGCCGACATCGTCGCCCTCGCCGCGCGCGACAGCACCGCCCTG
CTCGGCGGGCCGAGCTGGGCGGTGCCGCTCGGCCGGTGCGACTCGACGACGGCGAGCCGCAGCGAAGCGAAC
AGCGACCTGCCGGGGCCGGGGAGCAACCTCACCATGCTCATCGCGCGGTTCGGCAACAAGGGCCTAAGCCCGCGCGACATGACGGCGCTGTCGGGCTCGCACACCGTCGGCTTCTCGCAG
TGCACCAACTTCCGCGCCCACATCTACAACGACGCCAACATCGACCCGTCGTTCGCCGCGCTGCGCCGCCGCGCGTGCCCCGCCGCGGCACCCAACGGCGACACCAACCTGGCGCCGCTC
GACGTGCAGACGCAGAACGCGTTCGACAACGCCTACTACGGCAACCTGCTGGTCCGGCGAGGCCTGCTCCACTCCGACCAGGTGCTGTTCAACGGCGGGTCGCAGGACGCGCTGGTGAGG
CAGTACGCCGCCAACCCGGCGCTGTTCGCCGCCGACTTCGCCAAGGCGATGGTGAAGATGGGGAACATCGGGCAGCCCAGCGACGGCGAGGTCAGGTGCGACTGCAGGGTCGTCAACGAC
AGCTGA

Retrieve as FASTA