Entry information : ZmaPrx07 ( Zosma7g00170 [2.2])
Entry ID 10392
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2016-04-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-04-07 (Christophe Dunand)
Peroxidase information: ZmaPrx07 ( Zosma7g00170 [2.2])
Name (synonym) ZmaPrx07 ( Zosma7g00170 [2.2])
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Zosteraceae Zostera
Organism Zostera marina    [TaxId: 29655 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmaPrx07
start..stop
S start..stop
ZmaPrx39 531 0 12..332 19..341
VvPrx02 462 2e-165 8..331 5..325
MePrx24 460 2e-164 12..332 9..326
PtPrx27 458 1e-163 10..332 7..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 117577..117795 219 N° 2 117874..118074 201 N° 3 118154..118316 163 N° 4 118406..118821 416
join(117577..117795,117874..118074,118154..118316,118406..118821)


exon

Literature and cross-references ZmaPrx07 ( Zosma7g00170 [2.2])
Protein sequence: ZmaPrx07 ( Zosma7g00170 [2.2])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (306)
PWM (Da):   %s   36020.33 (33149.8) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.02 (8.02) Peptide Signal:   %s   cut: 27 range:27-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEKNIAGNLFWIAVLTIVLASATTQAQLQLGFYHRSCPKAESLIREFVQDHIPNAPSLAAALLRMHFHDCFVQGCDGSILLNVTTTTPTNATEKTAPPNLTLRGFDFIDRVKAVVEEECPGVVSCADVVALVARDSVVVTGGPSWNVPTGRRDGTISNATQALNGIPAPFFNFVNLTKSFAKVGLNVTDLVLLSGAHTIGIGHCSSFSKRLYNFTGVGDEDPSLDSEYAANLKKFKCKIPNDNVTFVEMDPGSVRTFDTHYYKLLLKRRGLFQSDAALTTDSNARDFVTNLVNGPPSNFFAAFGLSMEKMGRAHVKTGTQGQIRKHCALINN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAGAACATTGCAGGAAATTTGTTTTGGATTGCTGTTCTCACCATTGTGCTGGCTTCAGCTACTACTCAGGCGCAACTCCAGCTTGGTTTCTATCACCGGTCTTGTCCAAAAGCT
GAGAGTTTGATCAGAGAATTTGTTCAAGATCATATTCCAAATGCTCCCAGTCTGGCAGCTGCTCTTCTGAGGATGCACTTCCATGACTGTTTTGTTCAG
GTAATTTATTAAGTGATTATA
AATATTCTATAGGATGAACAGTATTAATGTTGAATTAATTGATATATATATATATAGGGTTGTGATGGTTCGATTCTTCTGAATGTGACTACAACTACCCCTACCAATGCCACTGAGAAA
ACTGCACCTCCGAATCTCACCCTTCGTGGGTTCGACTTCATTGACAGAGTCAAAGCCGTAGTGGAAGAGGAATGTCCCGGCGTGGTGTCGTGTGCTGATGTTGTTGCTTTGGTGGCTAGA
GACTCCGTCGTAGTCACT
GTAAGTAGAATATTTAAGCTAGATGTCAAAACGTACAATGGTGCTAACTACTGCATGCATGTGTTTGTAATTACTGCAGGGAGGGCCGTCTTGGAATGTTCC
GACGGGAAGAAGAGACGGGACGATATCAAATGCGACACAGGCTCTGAACGGCATTCCGGCTCCATTTTTTAACTTCGTAAATCTCACAAAATCATTTGCAAAAGTGGGACTTAATGTTAC
CGATCTTGTTCTTCTCTCCG
GTCAGTTCATATGATAATTAGTACGTAGTTATTATATATAACGTGAGTGAAAGTCAGATCAATGATGTATGTGATATTTTAATTTACAGGAGCTCACACG
ATCGGAATTGGGCACTGCTCGTCATTCAGCAAACGACTGTACAACTTCACCGGAGTAGGCGACGAGGACCCATCATTAGACAGCGAATACGCTGCGAATTTAAAGAAGTTCAAATGCAAG
ATCCCAAATGATAACGTGACGTTTGTCGAAATGGATCCCGGCAGTGTCCGGACTTTCGATACGCATTACTACAAACTTCTCCTGAAACGAAGAGGTCTCTTCCAGTCAGATGCCGCTTTG
ACTACGGATTCCAACGCCAGGGATTTTGTCACCAACCTCGTCAATGGACCGCCTTCGAATTTCTTCGCAGCTTTCGGATTATCCATGGAGAAAATGGGGAGAGCTCATGTCAAAACTGGG
ACTCAAGGTCAGATCAGAAAACACTGTGCATTGATAAACAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAGAACATTGCAGGAAATTTGTTTTGGATTGCTGTTCTCACCATTGTGCTGGCTTCAGCTACTACTCAGGCGCAACTCCAGCTTGGTTTCTATCACCGGTCTTGTCCAAAAGCT
GAGAGTTTGATCAGAGAATTTGTTCAAGATCATATTCCAAATGCTCCCAGTCTGGCAGCTGCTCTTCTGAGGATGCACTTCCATGACTGTTTTGTTCAG
GGTTGTGATGGTTCGATTCTT
CTGAATGTGACTACAACTACCCCTACCAATGCCACTGAGAAAACTGCACCTCCGAATCTCACCCTTCGTGGGTTCGACTTCATTGACAGAGTCAAAGCCGTAGTGGAAGAGGAATGTCCC
GGCGTGGTGTCGTGTGCTGATGTTGTTGCTTTGGTGGCTAGAGACTCCGTCGTAGTCACT
GGAGGGCCGTCTTGGAATGTTCCGACGGGAAGAAGAGACGGGACGATATCAAATGCGACA
CAGGCTCTGAACGGCATTCCGGCTCCATTTTTTAACTTCGTAAATCTCACAAAATCATTTGCAAAAGTGGGACTTAATGTTACCGATCTTGTTCTTCTCTCCG
GAGCTCACACGATCGGA
ATTGGGCACTGCTCGTCATTCAGCAAACGACTGTACAACTTCACCGGAGTAGGCGACGAGGACCCATCATTAGACAGCGAATACGCTGCGAATTTAAAGAAGTTCAAATGCAAGATCCCA
AATGATAACGTGACGTTTGTCGAAATGGATCCCGGCAGTGTCCGGACTTTCGATACGCATTACTACAAACTTCTCCTGAAACGAAGAGGTCTCTTCCAGTCAGATGCCGCTTTGACTACG
GATTCCAACGCCAGGGATTTTGTCACCAACCTCGTCAATGGACCGCCTTCGAATTTCTTCGCAGCTTTCGGATTATCCATGGAGAAAATGGGGAGAGCTCATGTCAAAACTGGGACTCAA
GGTCAGATCAGAAAACACTGTGCATTGATAAACAACTGA

Retrieve as FASTA