Entry information : EcamPrx31 ( EcC015286.10)
Entry ID 10393
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-11 (Christophe Dunand)
Peroxidase information: EcamPrx31 ( EcC015286.10)
Name (synonym) EcamPrx31 ( EcC015286.10)
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx31
start..stop
S start..stop
EguPrx31 659 0 1..323 1..323
EgrPrx31 659 0 1..323 1..323
EglPrx31 626 0 1..323 1..323
EgrPrx39 615 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 327..521 195 N° 3 695..1243 549  
join(1..228,327..521,695..1243)


exon

Literature and cross-references EcamPrx31 ( EcC015286.10)
Protein sequence: EcamPrx31 ( EcC015286.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35155.63 (32641.3)  
PI (pH):   %s   6.24 (5.96) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSSLNFFRALLLLFLATSAFSTRPYKEGLTPHFYDYACPQALPAVQRIVEAAVQQERRMGASLLRLHFHDCFVNGCDASILLDPSPTIDSEKLAFPNNNSARGFEVIDQIKAEVDKACGYSLVSCADILAIAARDSVVALGGPSWEVQLGRRDSTRASRTTANTDIPAPNMDLPSLISTFQKQGLDTRDLVALSGAHTIGFAQCRIFRNRTYNDANIAADFAGSLRSLCPRTGEDSNLAGLDPSPAQFDALYFHNLLAQKGLLHSDQALYSGGSTDELVKTYSDDAEAFWDDFAKSMIKMGNIKPLIGNQGQIRSNCRRLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGAGTAGCCTCAACTTCTTCCGAGCACTGCTCTTATTGTTCCTAGCGACGTCGGCTTTCTCGACGCGCCCTTACAAGGAAGGCCTCACGCCGCACTTCTACGACTACGCTTGT
CCTCAAGCTTTGCCTGCCGTCCAACGCATCGTGGAGGCAGCAGTGCAGCAGGAGCGACGCATGGGCGCTTCCTTACTGCGTTTGCATTTCCACGATTGCTTTGTTAAT
GTACGACATGTC
CACAATACTCTTAATTTCGCACTGGTTACTTAGCGGCGCTCTTACATGTCCTAATTTGATTTGTTTCCATTTATGCAATAATGTAGGGTTGCGATGCTTCAATACTTTTGGATCCATCCC
CTACCATTGACAGCGAAAAGCTCGCGTTTCCAAATAACAATTCAGCTAGAGGATTTGAAGTGATCGACCAAATTAAAGCAGAGGTGGACAAAGCTTGTGGATACTCACTCGTATCTTGCG
CAGACATCTTGGCCATCGCAGCTCGTGACTCTGTTGTTGCG
GTACATCTAATCTTAATCTCACCTATATTGTGGGTCATTATACCAAGCGTAGACAAGTAAAAGAGTCTTCAGCTAATTG
AAAACACTGTATAGCCACAGATACCCATGCATAACATTGCACATAAATGAGCAAAGTTCGATGTGAATATAAAAGGTTGACGTTCATATTTCAGCTTGGAGGGCCTTCATGGGAAGTACA
ACTTGGAAGGAGGGACTCGACCAGGGCGAGTAGGACAACGGCCAACACCGACATTCCCGCGCCAAACATGGACTTGCCTTCACTGATCAGCACGTTCCAAAAGCAAGGTCTCGACACACG
GGACTTGGTCGCACTGAGCGGTGCACACACAATTGGGTTCGCGCAATGTCGCATTTTCAGGAACCGCACATACAACGATGCCAACATCGCTGCCGATTTCGCTGGGAGCCTCCGGTCCTT
GTGCCCGCGTACTGGAGAGGACAGCAACCTCGCTGGTTTGGATCCTTCGCCGGCTCAATTCGACGCATTGTACTTCCACAATCTGTTGGCGCAAAAGGGGCTTCTTCACTCTGATCAGGC
GCTTTACAGTGGTGGGTCAACGGATGAGCTTGTGAAAACTTACAGCGATGATGCGGAGGCCTTTTGGGATGATTTTGCGAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATTGG
AAACCAGGGCCAGATTCGCTCAAATTGCCGAAGGTTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGAGTAGCCTCAACTTCTTCCGAGCACTGCTCTTATTGTTCCTAGCGACGTCGGCTTTCTCGACGCGCCCTTACAAGGAAGGCCTCACGCCGCACTTCTACGACTACGCTTGT
CCTCAAGCTTTGCCTGCCGTCCAACGCATCGTGGAGGCAGCAGTGCAGCAGGAGCGACGCATGGGCGCTTCCTTACTGCGTTTGCATTTCCACGATTGCTTTGTTAAT
GGTTGCGATGCT
TCAATACTTTTGGATCCATCCCCTACCATTGACAGCGAAAAGCTCGCGTTTCCAAATAACAATTCAGCTAGAGGATTTGAAGTGATCGACCAAATTAAAGCAGAGGTGGACAAAGCTTGT
GGATACTCACTCGTATCTTGCGCAGACATCTTGGCCATCGCAGCTCGTGACTCTGTTGTTGCG
CTTGGAGGGCCTTCATGGGAAGTACAACTTGGAAGGAGGGACTCGACCAGGGCGAGT
AGGACAACGGCCAACACCGACATTCCCGCGCCAAACATGGACTTGCCTTCACTGATCAGCACGTTCCAAAAGCAAGGTCTCGACACACGGGACTTGGTCGCACTGAGCGGTGCACACACA
ATTGGGTTCGCGCAATGTCGCATTTTCAGGAACCGCACATACAACGATGCCAACATCGCTGCCGATTTCGCTGGGAGCCTCCGGTCCTTGTGCCCGCGTACTGGAGAGGACAGCAACCTC
GCTGGTTTGGATCCTTCGCCGGCTCAATTCGACGCATTGTACTTCCACAATCTGTTGGCGCAAAAGGGGCTTCTTCACTCTGATCAGGCGCTTTACAGTGGTGGGTCAACGGATGAGCTT
GTGAAAACTTACAGCGATGATGCGGAGGCCTTTTGGGATGATTTTGCGAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATTGGAAACCAGGGCCAGATTCGCTCAAATTGCCGA
AGGTTGAACTGA

Retrieve as FASTA