Entry information : EcamPrx76 (EcC016881.10)
Entry ID 10394
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx76 (EcC016881.10)
Name (synonym) EcamPrx76 (EcC016881.10)
Class Class III peroxidase     [Orthogroup: Prx041]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx76
start..stop
S start..stop
EglPrx76 630 0 1..304 26..329
EgrPrx76 630 0 1..304 26..329
EguPrx76 628 0 1..304 26..329
PtPrx83 462 1e-165 1..304 35..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..135 135 N° 2 429..620 192 N° 3 814..979 166 N° 4 1411..1832 422
join(1..135,429..620,814..979,1411..1832)


exon

Literature and cross-references EcamPrx76 (EcC016881.10)
Protein sequence: EcamPrx76 (EcC016881.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   304
PWM (Da):   %s   34121.84  
PI (pH):   %s   4.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
VLGYYQEKCPLLEEIVRHSVERAVYREPRMAASLLRIHFHDCFVMGCDASVLLDSFDGMVSEKQAVPNLNSLRGLEVIDEIKYNLEEACPYTVSCADILAIVARDAVELRGGPRWEVWLGRRDSLKASFDGANKFIPAPNSSLEALIANFGQQGLDERDLVALSGSHTMGKARCVSFRQGIYEESTERQYDPFQRYTTFYDTLQSICPETGSDNRLASLDHVTPFEFDNHYFLNLLQGTGLLPSDNALINEDHEGVISRLVWTYASDTEAFFRDFANSVVKMGNINVLTESGGEIRRTCRFINT

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTTCTTGGGTACTACCAAGAGAAGTGCCCACTGTTGGAAGAAATCGTGCGGCATAGTGTCGAGCGTGCAGTGTATAGAGAGCCTCGGATGGCAGCATCTCTGCTACGTATCCATTTTCAC
GACTGTTTCGTCATG
GTTAGAAGAACATCTCTCTCTCAATCTCTCTTACGCGCCCTCTCTTGGGTGACACTGTAAATGATTTACAATATCCTATTGATTTGTGAAGTTGCAGTACTTGAA
TGTACACAGCAACTAGAAAATGTCTCATAAATTGACATTAGAGATTTCCATCAGTTCATCTGCCTAAATAAACCAGAACATGAGACGGTCCTTTTTAACTTTTCGTGGGAAAAGTAATTA
GTATTTTCGTTTTCCAGCCGCATCTTCTCTATGGGCTAACATCTCGTGTCATTCTTTTTGAGGATTAGGGTTGCGATGCATCAGTTCTTCTAGACAGCTTTGATGGCATGGTGAGCGAGA
AGCAGGCAGTGCCTAACCTTAACTCCTTGCGTGGGTTGGAGGTGATTGACGAGATAAAGTATAATCTGGAAGAGGCGTGTCCATACACAGTCTCCTGTGCTGATATTTTGGCCATTGTTG
CTCGAGATGCAGTCGAGCTG
GTAAGTAACTCAGGAAGCCATTTCTGATTGGAAAAATTTTAGTAGCCAGATACATTGTATGTTCACGTCATGTGTCGGTCAATCAAGATTTCCATTTCTG
ATGGACTCGTTCTTACTCTAAACCTAACCTTTCTCTAGTACGTCCACACTTAGCATCATATACACTGAGAAATTTCTTATCTCTGTGAAAAAGAGAGGAGGGCCCAGGTGGGAAGTGTGG
CTAGGCAGGAGAGACTCACTCAAGGCAAGCTTTGATGGAGCCAACAAATTCATACCTGCTCCAAATTCCTCCCTTGAAGCCCTAATTGCTAATTTCGGGCAACAGGGCCTGGACGAAAGA
GACTTGGTTGCCTTATCAG
GTGAAGTGTTTAGACTTAATTGAGTTCAAAAGTGAAATTTCTCGCGTTACAAAAAAATGGGTAATCCTTTGTTTGTAACTATTCGTGCCGAATCAATAGAT
TCATATCAGTTAATCATATAAAGAAGTTGACCATGTCATCATATAAAGTGTCTCAAAAGTTAAAAACAGCTCGAAACGAATCGCTAATGGTTTCAAGAGCTCGAAATAGTTCTCCAAATT
CTCATCTTGAGTATAATTTTTTGATGCCGTGATCTTTTGTACATTTGGCATTTCCTCTATATATTTATTGCTTTTACCAAAAAAAAAAAAAAAAAGTTCTCCTAATGTGCTTCAGTACGA
TGACTTTCACCTAAGCATACCATCAGTTTCTTCTTCCTCCCATTTTTTCTCAGTTAACACCGTTTTGTACGTCGAAAACTACGGAAGCAGGTAGTCACACGATGGGAAAAGCACGATGCG
TGAGCTTCAGGCAAGGGATTTACGAGGAAAGCACTGAACGACAGTACGATCCCTTCCAGAGATACACCACCTTCTACGATACCCTACAGTCCATATGCCCCGAGACCGGAAGTGATAATA
GATTAGCATCGCTTGATCACGTGACGCCTTTCGAGTTCGACAACCACTACTTCCTTAACCTCCTCCAAGGCACGGGTCTCCTACCATCTGATAATGCCCTCATCAATGAAGACCATGAAG
GTGTTATTTCGCGGCTTGTCTGGACTTATGCCTCGGATACAGAGGCTTTCTTCCGCGACTTTGCGAACTCGGTTGTGAAGATGGGGAACATCAACGTGCTCACCGAAAGTGGAGGAGAGA
TCAGGAGAACATGTCGATTCATCAACACTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTTCTTGGGTACTACCAAGAGAAGTGCCCACTGTTGGAAGAAATCGTGCGGCATAGTGTCGAGCGTGCAGTGTATAGAGAGCCTCGGATGGCAGCATCTCTGCTACGTATCCATTTTCAC
GACTGTTTCGTCATG
GGTTGCGATGCATCAGTTCTTCTAGACAGCTTTGATGGCATGGTGAGCGAGAAGCAGGCAGTGCCTAACCTTAACTCCTTGCGTGGGTTGGAGGTGATTGACGAG
ATAAAGTATAATCTGGAAGAGGCGTGTCCATACACAGTCTCCTGTGCTGATATTTTGGCCATTGTTGCTCGAGATGCAGTCGAGCTG
AGAGGAGGGCCCAGGTGGGAAGTGTGGCTAGGC
AGGAGAGACTCACTCAAGGCAAGCTTTGATGGAGCCAACAAATTCATACCTGCTCCAAATTCCTCCCTTGAAGCCCTAATTGCTAATTTCGGGCAACAGGGCCTGGACGAAAGAGACTTG
GTTGCCTTATCAG
GTAGTCACACGATGGGAAAAGCACGATGCGTGAGCTTCAGGCAAGGGATTTACGAGGAAAGCACTGAACGACAGTACGATCCCTTCCAGAGATACACCACCTTCTAC
GATACCCTACAGTCCATATGCCCCGAGACCGGAAGTGATAATAGATTAGCATCGCTTGATCACGTGACGCCTTTCGAGTTCGACAACCACTACTTCCTTAACCTCCTCCAAGGCACGGGT
CTCCTACCATCTGATAATGCCCTCATCAATGAAGACCATGAAGGTGTTATTTCGCGGCTTGTCTGGACTTATGCCTCGGATACAGAGGCTTTCTTCCGCGACTTTGCGAACTCGGTTGTG
AAGATGGGGAACATCAACGTGCTCACCGAAAGTGGAGGAGAGATCAGGAGAACATGTCGATTCATCAACACTTAA

Retrieve as FASTA