Entry information : EcamPrx17 (EcC017005.10)
Entry ID 10395
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status partial
Reviewer Li
Last annotation changes 2013-05-23 (Li)
Peroxidase information: EcamPrx17 (EcC017005.10)
Name (synonym) EcamPrx17 (EcC017005.10)
Class Class III peroxidase     [Orthogroup: Prx010]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx17
start..stop
S start..stop
EgrPrx17 473 4e-171 1..245 60..319
EgrPrx20 471 2e-170 1..245 60..319
EglPrx20 466 4e-169 1..245 21..280
EgrPrx18 466 2e-168 1..245 60..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3..41 39 N° 2 1105..1296 192 N° 3 1418..1583 166 N° 4 1721..2061 341
join(3..41,1105..1296,1418..1583,1721..2061)


exon

Literature and cross-references EcamPrx17 (EcC017005.10)
Protein sequence: EcamPrx17 (EcC017005.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   245
PWM (Da):   %s   26429.14  
PI (pH):   %s   7.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
SLLRLHFHDCFVNGCDASILLDDTTNFTGEKNAGPNANSMRGFEVIDTIKSELESKCPGIVSCADFLAVVARDFIIALGGPSWTVSLGRRDSTTASQSAANISIPPPTLNLSGLISAFSNKDFTAKEMVALLARCLTFREHLYNENNIDTMFATSLKANCPSSGGDSKLFPFDNAFFKNLQTHKVFLHSDQQLFSGGSTDVHVNAYSSILSTFRTDFANAMVKMGNLSPLIGSSGQIRKNCRKVN

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from kazusa. (5' end is missing)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCCTTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAATGCAAGTCCCTCTGCTCTGAGTCTCTCCTCTCTTTCCGATTGATTAGTACCGTTGTTTCTCTCCTTCATTCAAGCTGAATGC
AAGCGAGCATGCATGATGCATCTTTGTGCCTACGCATGTGAAGCGTTCCATCCAACCACATAGTCAAAAGAATCATTAGATTCGCTTCTACGCAAGTTATCGTACTCTCTTTTTCACTAA
CCAAACAGTAGGTAGGAGGTTGACATATTGAATTAGTTGAGATTTTTGGTGCTTTCTTGTGTCATGCATTTTTGTGAGTTTATTATACCAATAATCAATTCTGTTTATTACAGCATAATA
AGTTTTTTGGTAATTCGAAAAAACTTCATGATTATTTTTAGCATACATTGCCGGTGTAAAAATATTTTTCACAAACAATCTTATCCACTCTTAATTTGCCAGTTAGTGAGAGATTTGGTA
ATTAGAATCCTCCAATTACGAATGGCCAGGAATGCTTATGTAAAATTTTCTTTACATTGATGGTCTATGCTCTAATTTACCCCGGAAAAAACTACGCAGCAGAGCGTACTTTGCGCTAAC
TATGCTATTGATCAGATAAATGGGTATATAAATAACATTGGAGCTGGCAAAAAGAGAGAGATGGCCATTGCTTTTTATATCGGCGGTTGACTTTACTCGGTTATCACATTTGGCTAACCA
ATCAATTCTTTTCAAGAGATTTTGATCATATTATGATCACTTCACTGTGGCAGCGATATATTTTTACATAAAAAGTGATATGGATGGTAAAGTATCATTTTCAATGAAATTTGATAACTC
AATACTATTCTAAAATCGCACTAGATCTTTGAACAATCAAATCGTGCCTTTTGCATGGCCAAATTAGTTTGCTTTCACACAAATTCAAAGTGTCAATCTAAATTAACCAATCAATTTAGA
TCAGTATGTTCATAATGGGGGGCAAACTATTTCAGTAAAGATTATAGCACTGTTTGCAACCATTAAATCTAATTAACTCCAATCGGATCAATTTTCTATCTAGAAGGACTGATTAACAAC
ATGTGAAAAAAACATGAAATAGGGATGCGACGCGTCAATTTTATTGGACGACACTACGAACTTCACCGGGGAGAAGAACGCCGGCCCGAATGCCAATTCCATGCGGGGATTCGAGGTAAT
CGACACAATCAAGTCCGAATTGGAGAGCAAGTGCCCCGGTATCGTGTCTTGTGCTGATTTTTTAGCCGTCGTTGCACGAGACTTCATCATTGCC
GTAAGTGCACATTTTCGTCTCAATTG
TACTTATTAATTGTGACGAAAAAAAAACACATGTTATGTTCCTCATGCTATATTAATATTAACACGTATGGATTTGTTATTTATTTAAATTTTAGTTAGGTGGCCCTAGTTGGACAGTCT
CCCTTGGAAGAAGAGACTCAACCACCGCAAGTCAAAGTGCTGCTAATATTAGCATTCCTCCCCCAACTTTGAACCTTAGCGGCCTAATCTCTGCATTCTCTAACAAAGACTTCACAGCTA
AAGAAATGGTGGCACTTTTAG
GTCATTGTTTCTATTTTATTTTATTTTTGGTTGCAATTTTTAATAAAGAGTAACAATAATGCTCGATCGATATACTAAAAATCAATTTACAAAAATTGT
TCGACCATTGTTAACAAGGTCGCACACAATAAGTCAAGCCCGATGCCTGACTTTCCGGGAGCATCTTTACAACGAGAACAACATCGACACCATGTTCGCAACATCGCTGAAAGCAAATTG
CCCGAGCTCCGGAGGCGACAGCAAACTCTTTCCTTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAACAATTGTTCAGTGGTGGTTCCACGGA
CGTTCACGTGAATGCTTATAGTAGCATTTTGTCCACTTTTAGGACAGATTTTGCTAACGCCATGGTGAAAATGGGTAACCTTAGCCCACTCATTGGCTCAAGCGGTCAGATTAGAAAGAA
TTGCAGGAAAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCCTTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAATGGATGCGACGCGTCAATTTTATTGGACGACACTACGAACTTCACCGGGGAGAAGAACGCCGGCCCGAATGCCAATTCCATG
CGGGGATTCGAGGTAATCGACACAATCAAGTCCGAATTGGAGAGCAAGTGCCCCGGTATCGTGTCTTGTGCTGATTTTTTAGCCGTCGTTGCACGAGACTTCATCATTGCC
TTAGGTGGC
CCTAGTTGGACAGTCTCCCTTGGAAGAAGAGACTCAACCACCGCAAGTCAAAGTGCTGCTAATATTAGCATTCCTCCCCCAACTTTGAACCTTAGCGGCCTAATCTCTGCATTCTCTAAC
AAAGACTTCACAGCTAAAGAAATGGTGGCACTTTTAG
CCCGATGCCTGACTTTCCGGGAGCATCTTTACAACGAGAACAACATCGACACCATGTTCGCAACATCGCTGAAAGCAAATTGC
CCGAGCTCCGGAGGCGACAGCAAACTCTTTCCTTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAACAATTGTTCAGTGGTGGTTCCACGGAC
GTTCACGTGAATGCTTATAGTAGCATTTTGTCCACTTTTAGGACAGATTTTGCTAACGCCATGGTGAAAATGGGTAACCTTAGCCCACTCATTGGCTCAAGCGGTCAGATTAGAAAGAAT
TGCAGGAAAGTCAACTGA

Retrieve as FASTA