Entry information : OsPrx30
Entry ID 1040
Creation 2005-07-20 (Filippo Passardi)
Last sequence changes 2005-07-20 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx30
Name OsPrx30
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx30
start..stop
S start..stop
SiPrx77 513 0 2..326 3..320
ZmPrx123 509 0 1..327 1..324
SbPrx74 507 0 1..327 1..326
HvPrx13 501 0 1..326 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7937645..7938064 420 N° 2 7938140..7938703 564  
join(7937645..7938064,7938140..7938703)


exon

Literature and cross-references OsPrx30
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q6ER51
DNA ref. GenBank:   NC_008395.1 (7937645..7938700)
Protein sequence: OsPrx30
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (301)
PWM (Da):   %s   34318.16 (31616.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   7.62 (7.24) Peptide Signal:   %s   cut: 27 range:27-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRSSWHCCLLAFFLLSSAAGAAYGQQLSTTFYAASCPTLQVVVRATVLGALLAERRMGASLVRLFFHDCFVQGCDASILLDDVPATSFVGEKTAFPNVNSVRGYDVIDQIKRNVELLCPGVVSCADIVALAARDSTALLGGPSWAVPLGRRDSTTASLSAANSDLPAPSSDLATLIAGFGNKGLSPRDMTALSGAHTIGFSQCANFRDRVYNDTNIDPAFAALRRRGCPAAPGSGDSSLAPLDAQTQNVFDNAYYRNLLAQRGLLHSDQELFNGGSQDALVQQYSSNPALFAADFAAAMIKMGNIKPLTGAAGQIRRSCRAVNSS*

Retrieve as FASTA  
Remarks chromosome 2. 11 ESTs. Rice blast fungus interaction, leaf library induced by M.grisea.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGAGGAGTAGCTGGCATTGCTGCTTGCTGGCCTTCTTCCTCCTCTCGTCCGCCGCCGGCGCCGCCTACGGGCAGCAGCTGTCGACGACGTTCTACGCGGCGAGCTGCCCGACG
CTGCAGGTGGTGGTGCGCGCCACCGTGCTCGGCGCGCTCCTCGCCGAGCGGCGGATGGGCGCGTCCCTCGTCAGGCTCTTCTTCCACGACTGCTTCGTCCAGGGCTGCGACGCCTCCATC
CTCCTCGACGACGTGCCGGCGACGAGCTTCGTCGGCGAGAAGACGGCGTTCCCCAACGTCAACTCCGTCCGCGGCTACGACGTCATCGACCAGATCAAGCGCAACGTCGAGCTCCTCTGC
CCCGGCGTCGTCTCCTGCGCCGACATCGTCGCCCTCGCCGCCCGCGACAGCACCGCCCTG
GTACGCGCCGCCCACCGACACACACAATGTTCGAATTGATTCCATAGATTCTGACGGCGA
CGCGCGTACGTGCAGCTCGGCGGGCCAAGCTGGGCGGTGCCGCTGGGGCGGCGGGACTCGACGACGGCGAGCCTCAGCGCGGCGAACAGCGACCTGCCGGCGCCGTCGAGCGACCTCGCC
ACGCTCATCGCGGGGTTCGGCAACAAGGGCCTGAGCCCGCGCGACATGACGGCGCTCTCCGGCGCGCACACCATCGGCTTCTCGCAGTGCGCCAACTTCCGCGACCGCGTCTACAACGAC
ACCAACATCGACCCGGCGTTCGCCGCGCTCCGCCGCCGCGGCTGCCCCGCCGCGCCGGGCTCCGGCGACTCCAGCCTGGCGCCGCTCGACGCGCAGACGCAGAACGTGTTCGACAACGCC
TACTACCGCAACCTGCTCGCCCAGCGCGGCCTGCTCCACTCCGACCAGGAGCTCTTCAACGGCGGCTCGCAGGACGCGCTGGTGCAGCAGTACAGCTCCAACCCGGCGCTGTTCGCCGCC
GACTTCGCCGCCGCCATGATAAAGATGGGGAACATCAAACCGCTCACCGGAGCCGCCGGCCAGATCAGGCGCAGCTGCAGGGCCGTCAACAGCAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGAGGAGTAGCTGGCATTGCTGCTTGCTGGCCTTCTTCCTCCTCTCGTCCGCCGCCGGCGCCGCCTACGGGCAGCAGCTGTCGACGACGTTCTACGCGGCGAGCTGCCCGACG
CTGCAGGTGGTGGTGCGCGCCACCGTGCTCGGCGCGCTCCTCGCCGAGCGGCGGATGGGCGCGTCCCTCGTCAGGCTCTTCTTCCACGACTGCTTCGTCCAGGGCTGCGACGCCTCCATC
CTCCTCGACGACGTGCCGGCGACGAGCTTCGTCGGCGAGAAGACGGCGTTCCCCAACGTCAACTCCGTCCGCGGCTACGACGTCATCGACCAGATCAAGCGCAACGTCGAGCTCCTCTGC
CCCGGCGTCGTCTCCTGCGCCGACATCGTCGCCCTCGCCGCCCGCGACAGCACCGCCCTG
CTCGGCGGGCCAAGCTGGGCGGTGCCGCTGGGGCGGCGGGACTCGACGACGGCGAGCCTC
AGCGCGGCGAACAGCGACCTGCCGGCGCCGTCGAGCGACCTCGCCACGCTCATCGCGGGGTTCGGCAACAAGGGCCTGAGCCCGCGCGACATGACGGCGCTCTCCGGCGCGCACACCATC
GGCTTCTCGCAGTGCGCCAACTTCCGCGACCGCGTCTACAACGACACCAACATCGACCCGGCGTTCGCCGCGCTCCGCCGCCGCGGCTGCCCCGCCGCGCCGGGCTCCGGCGACTCCAGC
CTGGCGCCGCTCGACGCGCAGACGCAGAACGTGTTCGACAACGCCTACTACCGCAACCTGCTCGCCCAGCGCGGCCTGCTCCACTCCGACCAGGAGCTCTTCAACGGCGGCTCGCAGGAC
GCGCTGGTGCAGCAGTACAGCTCCAACCCGGCGCTGTTCGCCGCCGACTTCGCCGCCGCCATGATAAAGATGGGGAACATCAAACCGCTCACCGGAGCCGCCGGCCAGATCAGGCGCAGC
TGCAGGGCCGTCAACAGCAGCTGA

Retrieve as FASTA