Entry information : EcamPrx135 ( EcC020669.20)
Entry ID 10402
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2016-03-17 (Christophe Dunand)
Sequence status partial
Reviewer Achraf Jemmat
Last annotation changes 2016-03-17 (Achraf Jemmat)
Peroxidase information: EcamPrx135 ( EcC020669.20)
Name (synonym) EcamPrx135 ( EcC020669.20)
Class Class III peroxidase     [Orthogroup: Prx022]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx135
start..stop
S start..stop
EgrPrx135 406 2e-145 1..197 1..197
EglPrx135 403 3e-144 1..197 1..197
EguPrx135 397 5e-142 1..197 1..197
PpePrx08 273 4e-93 31..197 32..198
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..231 231 N° 2 495..686 192 N° 3 795..965 171  
join(1..231,495..686,795..965)


exon

Literature and cross-references EcamPrx135 ( EcC020669.20)
Protein sequence: EcamPrx135 ( EcC020669.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   198 (176)
PWM (Da):   %s   21714.2 (19318.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.1 (5.25) Peptide Signal:   %s   cut: 23 range:23-198
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASKHLLLFQITLISLILAVSCFPAHSPIGQLSPYYYDRSCPRLQWIVRSNVWAAFQKDTRIAASLLRLHFHDCIVDGCEGSVLLDDTVDMKGEKNALPNRNSLRGFEVIDAIKADLENFCPFTVSCTDILTLAAREAVYMSGGPYWAVLLGRRDGITASDKSANEQLPSPIEPLDNIIAKFTSKGLELKDVVVLSGT

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from kazusa (3' end is missing due to the ending of contig).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCAAGCACCTTTTGCTATTCCAAATCACATTGATTAGCTTGATCTTAGCAGTCTCTTGCTTCCCTGCTCATAGCCCGATAGGCCAGCTCTCTCCGTATTATTACGACAGATCG
TGCCCTCGCTTGCAATGGATCGTCAGATCCAACGTTTGGGCAGCCTTCCAGAAAGATACAAGGATTGCTGCCTCTCTTCTTCGATTACACTTTCATGACTGCATCGTCGAT
GTAAGTAAT
TCGATCCAAGTGTCGTCATGATTGCAGCTTATTTGCGTGCACTTTTCCTCGATGATAATTTTAGGTTCCGTCGCTTCTTCTCGGTTTGGCGACTTAGCAGAGATATGTACAGCACGTTTT
ATTAGGAAAAGTCTTGACGGCATATGTTTCGCATTTGCATTGCTACCTAACATCGTGACATGGTTAAGCATGTGACCGGACTCGAGGCTTATGTTTTCCCTAGACACTGAACAACACTAC
ACCATCGATGTTAGGGCTGCGAAGGATCCGTGCTTCTTGATGACACCGTAGACATGAAGGGCGAGAAGAACGCCTTGCCAAATCGCAACTCTCTCCGAGGCTTTGAAGTCATCGACGCTA
TAAAAGCCGACCTCGAGAATTTCTGCCCCTTCACTGTCTCGTGCACTGATATACTCACCCTAGCTGCAAGAGAAGCCGTCTATATG
GTACCTTCATAAACCCCAGCTCTCTTCTTCACGA
ATACAATAGTCGAGCATGGCTCCTAAGCTAATAAGCACTTAATGAAAAACTAATTGGCCTTGATGGAGTTTTAGTCAGGTGGACCTTATTGGGCCGTACTATTGGGAAGAAGAGATGGAA
TCACGGCTAGCGACAAGTCGGCCAATGAACAGTTACCGTCGCCTATTGAGCCTTTGGATAACATCATTGCTAAGTTCACTTCAAAGGGTCTGGAGTTGAAGGATGTTGTGGTCCTCTCAG
GTACT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCAAGCACCTTTTGCTATTCCAAATCACATTGATTAGCTTGATCTTAGCAGTCTCTTGCTTCCCTGCTCATAGCCCGATAGGCCAGCTCTCTCCGTATTATTACGACAGATCG
TGCCCTCGCTTGCAATGGATCGTCAGATCCAACGTTTGGGCAGCCTTCCAGAAAGATACAAGGATTGCTGCCTCTCTTCTTCGATTACACTTTCATGACTGCATCGTCGAT
GGCTGCGAA
GGATCCGTGCTTCTTGATGACACCGTAGACATGAAGGGCGAGAAGAACGCCTTGCCAAATCGCAACTCTCTCCGAGGCTTTGAAGTCATCGACGCTATAAAAGCCGACCTCGAGAATTTC
TGCCCCTTCACTGTCTCGTGCACTGATATACTCACCCTAGCTGCAAGAGAAGCCGTCTATATG
TCAGGTGGACCTTATTGGGCCGTACTATTGGGAAGAAGAGATGGAATCACGGCTAGC
GACAAGTCGGCCAATGAACAGTTACCGTCGCCTATTGAGCCTTTGGATAACATCATTGCTAAGTTCACTTCAAAGGGTCTGGAGTTGAAGGATGTTGTGGTCCTCTCAGGTACT

Retrieve as FASTA