Entry information : EcamPrx21 (EcC020909.20)
Entry ID 10405
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx21 (EcC020909.20)
Name (synonym) EcamPrx21 (EcC020909.20)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx21
start..stop
S start..stop
EcamPrx22 641 0 1..319 1..319
EgrPrx21 639 0 1..319 1..319
EglPrx21 639 0 1..319 1..319
EguPrx21 638 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..216 216 N° 2 1820..2011 192 N° 3 2119..2284 166 N° 4 2392..2777 386
join(1..216,1820..2011,2119..2284,2392..2777)


exon

Literature and cross-references EcamPrx21 (EcC020909.20)
Protein sequence: EcamPrx21 (EcC020909.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33277.39 (30581.0)  
PI (pH):   %s   8.15 (8.21) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARESSSVRSAFLLLLCFLLETASAQLSSTFYSTSCPSALSTIKSGVSSAVKSEARMGASLLRLHFHDCFVNGCDASVLLDDTANFTGEKNAGPNANSLRGFNVIDTIKSQLESACPGIVSCADLLTVAARDSVVALGGPSWTVPLGRRDSTTASQSAANSNIPAPTLSLSGLITAFSNKGFTAKEMVALSGSHTIGQARCTTFRTRLYNENNINTTFATSLKANCPSSGGDNNLSPLDTTSPTSFDNAYFKNLQIQKGLLHSDQQLFSGGSTDAQVNAYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKTCGKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGAGAGCTCCTCTGTCAGATCCGCCTTCTTATTGTTGCTGTGTTTTCTTCTGGAAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTTAAT
GCAAGTCCCTCTGCCCGGAGTCTT
TCCTCTCTTTCCGATTGATTGCTACCTTTGCTTCTCTTCTGTCATTCAAGCTGCATGCAAGCGTGCATGCATGATGCATCTTTGTGCTTTTGTGCATGTGAAACGTTCCAACCGACCTCA
TAGTCAAAAAGAATGATTAGATTTCGCTTCTACGCAAGTTACTCTCTTTTTCACTAACCAAACAATAGGTAGGAAGTACACATATTGAATTAATCGAGTCTGACCGACCCTTTTTGTGCC
ATGCATTTTTGTGAGTTTATTATTATAATAATAATAGGCTGTGTTTATTGAAGTCGTTTTAAAATTAGAGCTATGTTTTCATTCAAACTGCAATAAAAAGCACGGCCCTTAGAATAAAAG
CAATTCTTTTTGGTGATTCAAAGAAAAAAATTTCATGAGTAATTCTAGTATACACCACTAGTGTAAAAATCTCATTCCGTAAGTGGTCTTATCTACTAGATATTTTGGTGGTTGGGGAGA
GATTTGGTAATTAGAATCCTCGAATCAAGATGGACAAGAATATTGTTGTGCGTGCTCTAATTTTTTTTTTCATTTATTATATCGACAATGTAAGCCATGCAGGCGAGCGTATTTTATGCC
GAGTATGTTGTGGATAAGACGTGTTTGTGTATGATTAGCTACATGATTTTAAATTCGATGAATTAGATCACGCAAAAGTCCTAAACGTTGGAGATGGAAAAAAGAGAGAGCGACAGCCAT
GCTTTTATGACGGTGGTTGACTTTACGCGTTTATCATGTTTGGCAAATCAATCAGTTGTTTTCAATGGGTTTTGGTCATATTTTGATCACCGTCACTTTGGTTGCCATACTTTTCTACAT
TGAAAATGATAATTTGCTATAAAATGTCTTTTTTTAATGAAATTTGTTAATCCAATGGAGTTCTAAAAATTGTGTTAGATCTTTTGAACAATTTGAAGTACCTTCATTGTTATCCACTTC
GTGTTCTTTGTGCATAATTCAAGAGTTGTCCATATCCTAATGGGCCTTTCTCCATCAAACATGCCGTCTCTATTTCAAACTTGATATTTAAAGCCTGATCCATTTTTTACTAAAAAATGT
GACATGTTTACAACTTTATCGATTAGATGCTTTTCTCTTTTCCTGCATGTGTTGGAAATTGTCTAGATCTTCAAGGTCATTCGAGAAGACAAAATTCAGGCTAATTCTAGTAAATCAAAA
AGTCGGTGACTCCCCTCTGTTAAATATTAAAGGACATGCCATGTTGCTAACCAAAAGCCTTGATTTAGAGAACACTTCAGAGCACAATCATTTTGTTTCTAGTCCGACAATTACTGGATG
CATTATTCCTAGAGAGACAACACAAATTAAAGTCAAAAGGCACGAGAAAGAGTGTCATTCCCGTCCAAACTGGTGTCTGTAGGCGTTCATAATGGGGGACAAAAGGGGGAAAATGATAAG
GGAAATTAATCATTGTTCATATTTTATGTTCAGGAAAAGTTATAGCAGTCGTTCTGTTTATATTTTGACCGTTGAATCTAATGAATTCAATAGGATCGATTTGACTGATTAACGATGTGT
GGCACAAAATATAAAATAGGGATGCGACGCATCTGTTCTATTGGACGACACCGCGAACTTCACTGGGGAGAAGAATGCTGGCCCAAATGCCAATTCCTTACGGGGATTCAACGTGATTGA
CACAATCAAGTCCCAATTGGAGAGTGCATGCCCCGGCATCGTGTCCTGCGCTGATCTCTTGACCGTGGCTGCCCGAGATTCCGTCGTCGCT
GTAAGTGCAAACTTTTTTCTTAATTCTAG
TGAAAAAATCACTCGTTATGATCTCGATGCCGCATCAATACTAACACGTGTGGATTTGTTTAACTATTTAATTCTTAGTTAGGTGGTCCAAGTTGGACAGTCCCACTAGGAAGAAGAGAC
TCAACCACTGCAAGCCAAAGTGCTGCTAATAGCAACATCCCTGCCCCAACTTTGAGCCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCGCCAAAGAAATGGTGGCACTC
TCAG
GTCATTGTTTTTCCTCTTTTGTGGCACTTTTTAATAACGAATTTACAATAATGCTTGATCGATATACTAAGATTAGTATTAAAAAGTTGTTTGATTGTTGTTAATAGGGTCGCACA
CGATAGGTCAAGCCCGATGCACAACTTTCCGGACCCGTCTTTACAACGAGAACAACATCAACACCACGTTCGCGACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGCGACAACAATC
TCTCTCCTCTAGACACCACGAGCCCGACGTCCTTTGACAATGCCTACTTTAAGAACTTGCAAATCCAAAAAGGTCTTCTTCACTCGGACCAGCAATTGTTTAGTGGTGGTTCCACGGACG
CTCAAGTGAACGCTTATAGCAGCAATTCAGCAACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAAGACAT
GCGGGAAAGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGAGAGCTCCTCTGTCAGATCCGCCTTCTTATTGTTGCTGTGTTTTCTTCTGGAAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTTAAT
GGATGCGACGCATCTGTTCTATTG
GACGACACCGCGAACTTCACTGGGGAGAAGAATGCTGGCCCAAATGCCAATTCCTTACGGGGATTCAACGTGATTGACACAATCAAGTCCCAATTGGAGAGTGCATGCCCCGGCATCGTG
TCCTGCGCTGATCTCTTGACCGTGGCTGCCCGAGATTCCGTCGTCGCT
TTAGGTGGTCCAAGTTGGACAGTCCCACTAGGAAGAAGAGACTCAACCACTGCAAGCCAAAGTGCTGCTAAT
AGCAACATCCCTGCCCCAACTTTGAGCCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCGCCAAAGAAATGGTGGCACTCTCAG
GGTCGCACACGATAGGTCAAGCCCGA
TGCACAACTTTCCGGACCCGTCTTTACAACGAGAACAACATCAACACCACGTTCGCGACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGCGACAACAATCTCTCTCCTCTAGACACC
ACGAGCCCGACGTCCTTTGACAATGCCTACTTTAAGAACTTGCAAATCCAAAAAGGTCTTCTTCACTCGGACCAGCAATTGTTTAGTGGTGGTTCCACGGACGCTCAAGTGAACGCTTAT
AGCAGCAATTCAGCAACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAAGACATGCGGGAAAGTCAACTAA

Retrieve as FASTA