Entry information : EcamPrx176 (EcC021894.10)
Entry ID 10408
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx176 (EcC021894.10)
Name (synonym) EcamPrx176 (EcC021894.10)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx176
start..stop
S start..stop
EcamPrx58 607 0 1..325 1..328
EgrPrx176 595 0 13..301 1..289
MePrx88 503 0 8..325 3..319
LePrx91 497 2e-179 8..325 9..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..216 216 N° 2 599..790 192 N° 3 1418..1583 166 N° 4 2222..2622 401
join(1..216,599..790,1418..1583,2222..2622)


exon

Literature and cross-references EcamPrx176 (EcC021894.10)
Protein sequence: EcamPrx176 (EcC021894.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (301)
PWM (Da):   %s   35650.81 (33104.5)  
PI (pH):   %s   6.92 (7.44) Peptide Signal:   %s   cut: 25 range:25-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSNMSLVLVITIVVFFGHIGDSEGGDLRKNFYKNACPLAEEIVQNITWKHAASNSALPAKFLRMHFHDCFVRGCDGSVLLDSTANNKAEKVAVPNQSLTGFDVIDEIKEKLEETCPGVVSCADILALAARDSVSFQFKKSMWEVLTGRRDGRISRESEALSNIPSPFFNFTTLKQSFANKSLTLHDLVVLSGGHTIGVGHCNFFSNRLYNFTGKGDQDPSLDPTYASQLKAQCKTLSDNATTVAMDPGSPLSFDSHYYKALNRKQGLFQSDAALLTNMESRKIVNELLDQDGFFTEFGQSMKRMGAVEVLTGSNGEIRKKCNVI

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTAATATGAGCTTAGTGCTGGTAATCACCATAGTTGTCTTCTTTGGGCACATAGGGGACTCAGAAGGAGGGGACTTGAGGAAGAATTTCTACAAGAACGCATGTCCTCTTGCTGAG
GAAATAGTGCAGAATATCACGTGGAAGCATGCCGCCAGTAACTCAGCTTTGCCCGCCAAGTTCCTGAGGATGCATTTCCACGATTGCTTCGTTAGG
GTACGCACGTATATATACACTATA
ATCATCCATGCATTGCAGTAGATTAATCCCGACACTATGCCTATGCTGGAACTCTCATTAGGCTTGCATTTGCACGTACACCGGCCGGCGAACTCGCCTTGTGCATGAACTACCGTCGTT
TGACAGTGTCATCTATATATATAAAGTACCGTGGTTTGGCCGTGTCATATATATACATACACGAGTCTCTTGTTATGCCTAGATTGAACTGAGAACTGATATTCTTTAGAAGAATCATTT
CATTGTTCCATATGGTCGCACAAGGTAAAAAATCGATGCTTACGTGCATGATTGTAGGAGGAGAGTTTTGCGTGGTAATATTTCTTTGGTGCTTGATCGCATCGTTTCATGTGTGTAGGG
TTGCGATGGCTCGGTTTTGCTAGACTCGACGGCGAACAACAAGGCGGAGAAGGTGGCGGTTCCGAACCAGTCGCTAACCGGGTTCGACGTCATAGACGAGATCAAGGAGAAGCTGGAGGA
AACATGCCCTGGGGTCGTCTCTTGTGCCGACATCCTGGCTTTAGCTGCTAGAGACTCGGTCTCTTTCCAA
GTAAGACTTTTCGGGGGGTGATGAAAATCACTAGGGCCATTGATTGGTAT
TCTCTTGGGTTTGTTTCAACACTTCTGGAAACTTTTCTTTATGAGTTAGTAGAATTTTAATAACCTCATCAATGCTCCATTACACGTGCTCTTGAAAAAAATTATTGTGGAAAAAGCTTT
TTTAACCATCTGACGGCGACACTAGATTATCAAGAAAAAGCTCATCCATCTTCTAATGAATGCTATTCTCGATCCTACACATATATCAGCCCTAATTATATTTTGATTTGTGATCAATCC
ATAGGTAATAAAAAATATTCACTGGTCCTTATCATTATCCAATTGAACGCTATTGCTTCTACAAAAAGTGTCCCGACACTTTCTATGAAAAAGTTCAATAAGGTCGATCGATTTGAGAAA
CAAACGTACCTCTTTTTTTTTTTTTTTTCCAAAATTAAAGTTTTCTCTTGTTTCTGGTTGTTGAAAATTCCCACTAATAATGTGCAAATCACTCACAACAAAGTTGATCCCGATATTGGC
CGGCAGCTTCTAACATAGTGTATTTATATTATGATATACATTAATTTGACATTTTAGTGGATCTCACATGATTGCCACAATTAATTGTGATTTGCAGTTCAAAAAGTCGATGTGGGAGGT
GTTGACTGGAAGAAGAGATGGGAGAATTTCACGTGAATCAGAAGCGCTTTCCAATATTCCTTCCCCATTCTTCAACTTTACAACTCTCAAGCAATCTTTTGCCAACAAGAGCCTCACTCT
TCACGACCTTGTTGTCTTATCAG
GTAAATCAAATATAAAAAAAATTTCACATTTTATAGGGTCAAAATTAGCCATGTGCTCGTAGGACCTAATGTCCAGTAAGTCAATTTCCCTTTTCGG
GTCATTTATTTCTTTTTCTTTTTGTGTGTGTATGTGTGTGAATATTTTCATAAGAATACACATGAATTGTATCGGATTCTCTCTCTGAAAAATATTTAATGAAATACCCTTTTCTCGTTC
CTGAAAAGGGAAACCAATTGATTAATGTGCTTATTATCTTCTCAAATATCCCTTGACAAATGTGCTATAGGAATTATATGAAAAGCATAAGTAAACAGTTTTCCCTAATGACGGTGAACA
AATGGAAACTCATAGCCCCATACATATAGAGAGAATCTGAAGGTCCGATTATTATGAATTGTATATTTTGCAATTTTTCTAAAATTTTAAAAAAGACAAAAATATATCTTTAATGTTAAA
TGAAAAAATCATAAACGATATACATATATATCATAATGTTTATATTTTTTTGGAAAGTTCTCAAGCACTCGACTTGGAAAAAAGGGTCAACTTTCAAACTCTATAAGAAAAGGAAAATTC
AATCTTCTAAGAAGCAAAGTTGAATGAATTAATTAAGTACACGACATGTCTGGGTCATCAGGTGGGCACACGATTGGGGTCGGGCACTGCAACTTCTTCAGCAACAGGCTCTACAACTTC
ACCGGAAAAGGCGACCAAGACCCGTCCCTCGACCCGACCTACGCCTCTCAACTGAAGGCTCAATGCAAGACGCTCTCCGATAACGCCACCACTGTCGCGATGGACCCCGGAAGCCCCCTC
TCCTTCGACAGCCATTACTACAAGGCCTTGAACCGAAAGCAGGGCCTCTTCCAGTCCGACGCCGCGCTCCTGACCAACATGGAGTCGAGGAAGATCGTCAACGAGTTGCTGGACCAGGAT
GGCTTCTTCACCGAGTTCGGCCAGTCGATGAAACGGATGGGCGCGGTCGAGGTGCTCACGGGGAGCAACGGCGAGATCCGGAAGAAATGTAACGTGATTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTAATATGAGCTTAGTGCTGGTAATCACCATAGTTGTCTTCTTTGGGCACATAGGGGACTCAGAAGGAGGGGACTTGAGGAAGAATTTCTACAAGAACGCATGTCCTCTTGCTGAG
GAAATAGTGCAGAATATCACGTGGAAGCATGCCGCCAGTAACTCAGCTTTGCCCGCCAAGTTCCTGAGGATGCATTTCCACGATTGCTTCGTTAGG
GGTTGCGATGGCTCGGTTTTGCTA
GACTCGACGGCGAACAACAAGGCGGAGAAGGTGGCGGTTCCGAACCAGTCGCTAACCGGGTTCGACGTCATAGACGAGATCAAGGAGAAGCTGGAGGAAACATGCCCTGGGGTCGTCTCT
TGTGCCGACATCCTGGCTTTAGCTGCTAGAGACTCGGTCTCTTTCCAA
TTCAAAAAGTCGATGTGGGAGGTGTTGACTGGAAGAAGAGATGGGAGAATTTCACGTGAATCAGAAGCGCTT
TCCAATATTCCTTCCCCATTCTTCAACTTTACAACTCTCAAGCAATCTTTTGCCAACAAGAGCCTCACTCTTCACGACCTTGTTGTCTTATCAG
GTGGGCACACGATTGGGGTCGGGCAC
TGCAACTTCTTCAGCAACAGGCTCTACAACTTCACCGGAAAAGGCGACCAAGACCCGTCCCTCGACCCGACCTACGCCTCTCAACTGAAGGCTCAATGCAAGACGCTCTCCGATAACGCC
ACCACTGTCGCGATGGACCCCGGAAGCCCCCTCTCCTTCGACAGCCATTACTACAAGGCCTTGAACCGAAAGCAGGGCCTCTTCCAGTCCGACGCCGCGCTCCTGACCAACATGGAGTCG
AGGAAGATCGTCAACGAGTTGCTGGACCAGGATGGCTTCTTCACCGAGTTCGGCCAGTCGATGAAACGGATGGGCGCGGTCGAGGTGCTCACGGGGAGCAACGGCGAGATCCGGAAGAAA
TGTAACGTGATTAAT

Retrieve as FASTA