Entry information : EcamPrx152 ( EcC026645.10)
Entry ID 10414
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-13 (Achraf Jemmat)
Peroxidase information: EcamPrx152 ( EcC026645.10)
Name (synonym) EcamPrx152 ( EcC026645.10)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx152
start..stop
S start..stop
EgrPrx152 621 0 1..309 1..309
EguPrx152 621 0 1..309 1..309
EglPrx152 617 0 1..309 1..309
EgrPrx150 607 0 1..309 1..309
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..162 162 N° 2 409..1173 765  
join(1..162,409..1173)


exon

Literature and cross-references EcamPrx152 ( EcC026645.10)
Protein sequence: EcamPrx152 ( EcC026645.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   309
PWM (Da):   %s   32884.46  
PI (pH):   %s   8.4
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLNSGSATLQVGFYRSACPAAESVVRKAVNKAVARNPGTGAGLIRMHFHDCFVRGCDASILLDSTLGNPSEKEHPANDPSLRGYEVIDKAKAELEHLCPQTVSCADILAFAARDSTYKLGSINYAVPAGRRDGLVSLRDEPSQNLPPPSLDAQQLEANFARKGLSLDEMVTLSGAHSIGVSHCSSFSNRLYSFNATHKQDPSLEPKLASELKAKCPNNGGTSDPTVPLDFVTANGLDNKYNTNLKKHRGVLTSDQTLFNSPSTTHIVRRNANHGGAWASKFAAAMV*MGSIDVLNGSQGEIRRNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron1). Incorrect prediction from kazusa (Stop in frame maybe due to bad sequenceing; real Stop is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGAACTCAGGTTCAGCAACTCTCCAAGTTGGATTTTACCGTTCCGCTTGCCCGGCTGCAGAGTCTGTCGTTCGAAAAGCCGTGAACAAGGCGGTGGCCAGAAATCCCGGCACTGGC
GCCGGGCTTATTAGAATGCACTTCCACGATTGCTTTGTTCGG
GTATGCAAACACTTCTTACCACATTTCTGAAGTAGCAGTAACAATCTCGATTTCAATAAGCAGTAGCGACGATAAACT
TTTCCTAGCGAAAGAAGTTCTGTTGATATTTTGTTATTACAAAGGATATTAGTTAGATGCGAGTATATTCACCTAGTCCAACATAAAAGTAACTTAATAATCGACGTTCCTTACGCAGAT
GCATTTCAGCAATTCTGATGATGTTCGTATTTTTTGAAAAAATAATAGGGTTGCGATGCATCAATTTTGCTCGATTCAACACTGGGCAACCCATCAGAGAAGGAGCATCCCGCGAACGAC
CCAAGCTTACGAGGCTACGAAGTCATCGACAAGGCGAAGGCCGAGCTAGAGCATCTATGCCCCCAGACGGTCTCTTGTGCCGATATTCTGGCATTCGCAGCCCGCGACAGCACCTACAAG
CTTGGCAGCATTAACTATGCAGTCCCGGCTGGTCGCCGCGATGGGCTAGTCTCCCTCAGAGACGAGCCGTCCCAGAATCTTCCCCCTCCTTCCTTGGATGCTCAACAGTTAGAAGCTAAT
TTTGCAAGGAAAGGTCTCTCTCTAGACGAAATGGTGACACTATCCGGTGCGCATTCGATCGGAGTCTCGCACTGTTCCTCCTTCTCGAACCGCTTGTACTCCTTCAACGCCACGCACAAG
CAAGACCCTTCATTGGAACCCAAGTTGGCCAGTGAACTGAAAGCGAAATGTCCGAACAATGGTGGCACCAGCGACCCGACGGTCCCATTGGACTTTGTCACTGCCAACGGGCTCGACAAC
AAGTACAACACTAATTTAAAGAAACACCGAGGCGTACTGACTTCAGATCAAACGCTTTTTAATAGCCCTTCGACGACACATATTGTGAGGAGGAACGCTAATCATGGCGGAGCATGGGCT
AGCAAATTTGCAGCTGCAATGGTGTAGATGGGATCAATTGATGTTCTCAACGGGAGCCAGGGCGAGATTAGGAGGAATTGCAGAGTTGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGAACTCAGGTTCAGCAACTCTCCAAGTTGGATTTTACCGTTCCGCTTGCCCGGCTGCAGAGTCTGTCGTTCGAAAAGCCGTGAACAAGGCGGTGGCCAGAAATCCCGGCACTGGC
GCCGGGCTTATTAGAATGCACTTCCACGATTGCTTTGTTCGG
GGTTGCGATGCATCAATTTTGCTCGATTCAACACTGGGCAACCCATCAGAGAAGGAGCATCCCGCGAACGACCCAAGC
TTACGAGGCTACGAAGTCATCGACAAGGCGAAGGCCGAGCTAGAGCATCTATGCCCCCAGACGGTCTCTTGTGCCGATATTCTGGCATTCGCAGCCCGCGACAGCACCTACAAGCTTGGC
AGCATTAACTATGCAGTCCCGGCTGGTCGCCGCGATGGGCTAGTCTCCCTCAGAGACGAGCCGTCCCAGAATCTTCCCCCTCCTTCCTTGGATGCTCAACAGTTAGAAGCTAATTTTGCA
AGGAAAGGTCTCTCTCTAGACGAAATGGTGACACTATCCGGTGCGCATTCGATCGGAGTCTCGCACTGTTCCTCCTTCTCGAACCGCTTGTACTCCTTCAACGCCACGCACAAGCAAGAC
CCTTCATTGGAACCCAAGTTGGCCAGTGAACTGAAAGCGAAATGTCCGAACAATGGTGGCACCAGCGACCCGACGGTCCCATTGGACTTTGTCACTGCCAACGGGCTCGACAACAAGTAC
AACACTAATTTAAAGAAACACCGAGGCGTACTGACTTCAGATCAAACGCTTTTTAATAGCCCTTCGACGACACATATTGTGAGGAGGAACGCTAATCATGGCGGAGCATGGGCTAGCAAA
TTTGCAGCTGCAATGGTGTAGATGGGATCAATTGATGTTCTCAACGGGAGCCAGGGCGAGATTAGGAGGAATTGCAGAGTTGTGAAC

Retrieve as FASTA