Entry information : EcamPrx200 ( EcC027380.40)
Entry ID 10416
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-23 (Christophe Dunand)
Peroxidase information: EcamPrx200 ( EcC027380.40)
Name (synonym) EcamPrx200 ( EcC027380.40)
Class Class III peroxidase    [Orthogroup: Prx136]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx200
start..stop
S start..stop
EgrPrx169 616 0 1..320 1..320
EcamPrx188 595 0 1..320 1..319
EgrPrx167 546 0 1..320 1..320
EguPrx167 540 0 1..320 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..219 219 N° 2 788..979 192 N° 3 1069..1620 552  
join(1..219,788..979,1069..1620)


exon

Literature and cross-references EcamPrx200 ( EcC027380.40)
Protein sequence: EcamPrx200 ( EcC027380.40)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (295)
PWM (Da):   %s   34108.82 (31376.4) Transmb domain:   %s   i9-28o
PI (pH):   %s   7.66 (6.88) Peptide Signal:   %s   cut: 26 range:26-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASNTNRKIYFVFFICAIALSSALAQLSNQDYYTQSCPRALETIGSAVRSAVAKETRMGASLLRLHFHDCFVNGCDASILLDNTTNFTGEKTAFPNANSVRGFDVIDAIKSKVEKLCPGVVSCADILAVAARDSVVILDGPSWQVQLGRRDSTTASLNDANTDLPAPTLNLRGLVTSFSNKGFTAKEMVTLSGSHTIGQARCVTFRARLYNESNISPSFAMSLKSNCPSSGGDNNLSPLDVTSPMFFDNAYFSNLVSQEGLLHSDQQLFSGGSTDAQVAAYSKNLGSFMNDFADAMVKMGGLSPLTGSSGQIRTNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic 'introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCAATACAAACCGGAAGATCTACTTCGTCTTCTTCATTTGTGCGATCGCGTTGAGCTCCGCCTTGGCGCAATTGTCTAACCAAGACTACTACACGCAAAGTTGCCCGAGAGCA
CTGGAGACCATCGGATCTGCTGTGAGATCGGCGGTTGCCAAAGAGACTCGCATGGGAGCATCCTTGCTCCGACTTCACTTTCACGATTGCTTTGTCAAT
GCAAGTCTCTTCCGCTTTCTC
GCTCAGTTCTATCCTTTTTCCTTCATGTCCAGTTTCGTGTATGTTTTGCATGTTCTTTTACGTGCAAACTTTTACTTCATTCCCAATCCATAATAGGATTACTCTTCCTCCACGTTTATT
TTCGATGGTTCCTCGCATGTCTGCTTAATTCACTCCTGATTGAAAATGGCCAACATTTTGGAGATTCGGATCTTTGAGGAATATTGCAACAAGTGAGATACGCGGGCCAATGATTCCATT
AAATTAAGAAAGAACACGCATTGAGCTGATCATAGCACACCATTTAGACGACCTGCCAACCTTGTGTCTCTAACTATGTCTTTTTTTCATCTAAAATTTATTTGTTCTTTGGTCGCTATA
TCTTATTCTATTCTAACCGATGAAATGTCTCTCTTAACATTCCTTTCCGGTTGCTTGCAAAAAAAAAAAAAAATTATTTTGTTTCCTCATAGGGGGTTCAATATTTAGATGATCCTTTCT
GATTCGTTAGATCTTCACAACTTAATAAAATGTTAATTTTTCCTTTTTTTTTTCTTTTTTTTGATAGGGATGTGATGCGTCCATTTTACTAGACAACACCACGAACTTCACTGGGGAGAA
AACAGCGTTTCCCAACGCAAACTCCGTGAGGGGATTCGACGTGATTGACGCCATCAAGTCAAAAGTGGAGAAACTGTGTCCTGGCGTTGTCTCGTGCGCTGACATCTTAGCTGTTGCTGC
TAGGGACTCCGTCGTCATT
GTAAGCATCGACACTTGAAATTTCTTTAAACATACAAAGAAACTATTATTTTCCTAAACTTATGTGGGTTAAATTAATTTGACATTTAGTTAGATGGACCG
AGTTGGCAAGTCCAACTGGGAAGAAGAGATTCAACCACAGCGAGCCTAAATGATGCTAATACCGACCTCCCAGCTCCAACTCTTAATCTCAGAGGTCTCGTCACCTCTTTCTCTAACAAA
GGCTTTACTGCCAAAGAAATGGTAACACTATCAGGATCCCACACCATAGGCCAGGCCAGGTGCGTGACGTTTCGGGCTCGACTCTACAACGAGAGCAACATAAGCCCATCATTCGCCATG
TCTTTGAAGTCCAATTGCCCCAGCTCAGGAGGCGACAACAACCTCTCCCCTCTCGACGTCACAAGCCCGATGTTCTTTGACAATGCCTACTTCAGCAACTTGGTGAGCCAAGAGGGCCTG
CTTCATTCGGATCAGCAGTTGTTTAGTGGAGGTTCGACGGATGCTCAAGTGGCTGCCTACAGCAAAAATTTGGGTTCATTCATGAACGATTTTGCCGATGCCATGGTCAAGATGGGAGGC
CTTAGTCCTCTCACCGGATCTAGCGGTCAGATCAGGACCAATTGCAGAAAAGTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCAATACAAACCGGAAGATCTACTTCGTCTTCTTCATTTGTGCGATCGCGTTGAGCTCCGCCTTGGCGCAATTGTCTAACCAAGACTACTACACGCAAAGTTGCCCGAGAGCA
CTGGAGACCATCGGATCTGCTGTGAGATCGGCGGTTGCCAAAGAGACTCGCATGGGAGCATCCTTGCTCCGACTTCACTTTCACGATTGCTTTGTCAAT
GGATGTGATGCGTCCATTTTA
CTAGACAACACCACGAACTTCACTGGGGAGAAAACAGCGTTTCCCAACGCAAACTCCGTGAGGGGATTCGACGTGATTGACGCCATCAAGTCAAAAGTGGAGAAACTGTGTCCTGGCGTT
GTCTCGTGCGCTGACATCTTAGCTGTTGCTGCTAGGGACTCCGTCGTCATT
TTAGATGGACCGAGTTGGCAAGTCCAACTGGGAAGAAGAGATTCAACCACAGCGAGCCTAAATGATGCT
AATACCGACCTCCCAGCTCCAACTCTTAATCTCAGAGGTCTCGTCACCTCTTTCTCTAACAAAGGCTTTACTGCCAAAGAAATGGTAACACTATCAGGATCCCACACCATAGGCCAGGCC
AGGTGCGTGACGTTTCGGGCTCGACTCTACAACGAGAGCAACATAAGCCCATCATTCGCCATGTCTTTGAAGTCCAATTGCCCCAGCTCAGGAGGCGACAACAACCTCTCCCCTCTCGAC
GTCACAAGCCCGATGTTCTTTGACAATGCCTACTTCAGCAACTTGGTGAGCCAAGAGGGCCTGCTTCATTCGGATCAGCAGTTGTTTAGTGGAGGTTCGACGGATGCTCAAGTGGCTGCC
TACAGCAAAAATTTGGGTTCATTCATGAACGATTTTGCCGATGCCATGGTCAAGATGGGAGGCCTTAGTCCTCTCACCGGATCTAGCGGTCAGATCAGGACCAATTGCAGAAAAGTCAAT
TGA

Retrieve as FASTA