Entry information : EcamPrx163 (EcC029221.30)
Entry ID 10419
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx163 (EcC029221.30)
Name (synonym) EcamPrx163 (EcC029221.30)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx163
start..stop
S start..stop
EgrPrx163 650 0 1..326 1..326
EguPrx163 649 0 1..326 1..326
EglPrx163 640 0 1..326 1..326
EgrPrx161 635 0 1..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..222 222 N° 2 658..846 189 N° 3 1290..1455 166 N° 4 1567..1970 404
join(1..222,658..846,1290..1455,1567..1970)


exon

Literature and cross-references EcamPrx163 (EcC029221.30)
Protein sequence: EcamPrx163 (EcC029221.30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (300)
PWM (Da):   %s   34874.82 (32121.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.06 (9.06) Peptide Signal:   %s   cut: 27 range:27-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAQKLLSLLVFQLALVAFILDVANAQGLKIGFYKNTCPQAEEIVKKAAASFISRAPSLAAPLLRMHFHDCFVRGCDGSVLLNSTSSNQAEKDAFPNLSLRGFQVIDAAKDALEKKCPGVVSCADILALVARDAVSMMNGPFWQVPTGRRDGRVSQLQDALNNLPGPAFGISALKSSFAGKGLSVKDLVVLSGGHTLGMSHCSSFTNRLYNFTGKNDADPSMDPNYVAQLKTKCKPNDATTIVEMDPGSAKKFDVDYYTLVSKRRGLFQSDAALLTDSTTNAYVQLQLTSKSTFAKDFGVSMVNMGNIGVLTGNSGEIRKKCYLVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTCAGAAGCTTCTCTCTCTCCTGGTTTTCCAGCTCGCGCTCGTCGCTTTTATTCTCGACGTCGCCAATGCTCAAGGCCTCAAAATAGGGTTCTACAAGAATACGTGCCCTCAG
GCTGAGGAGATAGTTAAGAAAGCGGCGGCGAGCTTCATTTCTCGAGCCCCCTCTCTTGCCGCTCCTCTCTTGAGGATGCATTTCCATGACTGCTTCGTCAGG
GTACTTCTATTTTAGCGG
TTAAATCCACTCGAGTGACCCCGTTGCCATCAATTTCTCAATTACTGCATGTAGTTTCTTTGAATCAAACATATGCACATCACTCCCCACATCATTAATTTGTTGCGAAATAAGTTGTAG
CTATAATTAGTTGATGTGTAGAGATCTATCTTAATTAGATAACCTGTTTTATGTTAGTAGATACATTTGCGTTCCTTAAAACAATCCGTCTCTGGATAATCAAACTTGATTTTGGAGGAC
ACCTATGTTGTGCGCAGTCAAATGTCTCGTTTTCCTGATTCGAAACTTCATGTCATGAAATGAGACAAATTTACCATATTACAAATTCATGCAGAGGCAAGCACCTTCACTAAGTTCTAA
AGTTCCTTTTTTTTTTTTTTGCCTTTCTTTCCCTCTCTTTTTTGGGTTTATTTGCAGGGATGTGATGGCTCTGTGCTACTGAATTCAACATCTTCTAACCAAGCAGAGAAAGATGCGTTT
CCAAACCTGTCACTGAGAGGATTCCAAGTCATCGACGCAGCCAAAGATGCCCTTGAAAAAAAATGTCCTGGTGTTGTCTCTTGTGCTGACATTCTTGCTCTAGTTGCTCGTGATGCAGTT
TCCATG
GTAATTGATTAATTAAAGATTCGATTCCTGTTGTATTCTAGCTAGGGATTTCTATAATGCTGGTCATCAACGAAAATTGTTTCATAAATTCTATTTTTTTTGTGATAAATCAAC
AATTTATCAATGATTTCGAACGTAATTGATTATTGAAATTTTTTTCTTAATGAGCGTGTCGACAACGTAAACTGATCAGATTGCAAGTCATCTGCACAGGTCAAAAACTTGGACTCAACT
AGTTCATGTGGTTTGTAGAGTGCTACTCGGGTCTTTGTGTCCACGCCCCTAAATAACAAGTGATGTCAATTTATGAAATGTGATATGATTTTTCTAAATTGTTGGTTGGATAACACAGCT
AATGGATATGGAATTTTCTAGTTTTTACCATGAAGGTATAGAGTAGGAATGTCAAATATCTTTAACTTGTAATTGGATTATGGTTTCAGATGAACGGTCCATTTTGGCAAGTCCCCACAG
GAAGGAGGGATGGCAGAGTGTCTCAGCTCCAAGATGCCTTAAACAACTTGCCCGGTCCTGCTTTCGGCATTTCTGCGCTTAAATCGTCCTTTGCCGGGAAGGGTCTCAGCGTCAAAGACC
TTGTCGTTCTCTCAG
GTACGAGACCAATCATAGTACATATACCTAACATTATTGAAAGTCCTAATCATTAGTTTATAATTCAAGTACAGTGAAATTAACGGTGTGGTTGCATCGATGATT
ATTCAGGAGGACACACCCTCGGAATGTCGCATTGTTCCTCTTTCACGAACCGTCTGTACAACTTCACCGGCAAGAACGACGCCGACCCATCCATGGACCCCAACTATGTCGCTCAGCTCA
AGACCAAGTGCAAGCCGAACGACGCCACCACCATCGTCGAGATGGACCCGGGGAGCGCCAAGAAGTTTGACGTGGACTACTACACCCTCGTCTCCAAGAGGAGAGGCCTCTTCCAGTCCG
ATGCCGCGCTGCTCACCGACAGCACCACCAACGCCTACGTGCAGCTCCAGCTGACGAGCAAATCGACATTTGCCAAAGACTTTGGCGTGTCCATGGTAAACATGGGCAACATCGGCGTTC
TCACCGGCAATTCGGGCGAGATTAGGAAGAAATGCTATTTGGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTCAGAAGCTTCTCTCTCTCCTGGTTTTCCAGCTCGCGCTCGTCGCTTTTATTCTCGACGTCGCCAATGCTCAAGGCCTCAAAATAGGGTTCTACAAGAATACGTGCCCTCAG
GCTGAGGAGATAGTTAAGAAAGCGGCGGCGAGCTTCATTTCTCGAGCCCCCTCTCTTGCCGCTCCTCTCTTGAGGATGCATTTCCATGACTGCTTCGTCAGG
GGATGTGATGGCTCTGTG
CTACTGAATTCAACATCTTCTAACCAAGCAGAGAAAGATGCGTTTCCAAACCTGTCACTGAGAGGATTCCAAGTCATCGACGCAGCCAAAGATGCCCTTGAAAAAAAATGTCCTGGTGTT
GTCTCTTGTGCTGACATTCTTGCTCTAGTTGCTCGTGATGCAGTTTCCATG
ATGAACGGTCCATTTTGGCAAGTCCCCACAGGAAGGAGGGATGGCAGAGTGTCTCAGCTCCAAGATGCC
TTAAACAACTTGCCCGGTCCTGCTTTCGGCATTTCTGCGCTTAAATCGTCCTTTGCCGGGAAGGGTCTCAGCGTCAAAGACCTTGTCGTTCTCTCAG
GAGGACACACCCTCGGAATGTCG
CATTGTTCCTCTTTCACGAACCGTCTGTACAACTTCACCGGCAAGAACGACGCCGACCCATCCATGGACCCCAACTATGTCGCTCAGCTCAAGACCAAGTGCAAGCCGAACGACGCCACC
ACCATCGTCGAGATGGACCCGGGGAGCGCCAAGAAGTTTGACGTGGACTACTACACCCTCGTCTCCAAGAGGAGAGGCCTCTTCCAGTCCGATGCCGCGCTGCTCACCGACAGCACCACC
AACGCCTACGTGCAGCTCCAGCTGACGAGCAAATCGACATTTGCCAAAGACTTTGGCGTGTCCATGGTAAACATGGGCAACATCGGCGTTCTCACCGGCAATTCGGGCGAGATTAGGAAG
AAATGCTATTTGGTTAACTAA

Retrieve as FASTA