Entry information : EcamPrx123 (EcC030196.10)
Entry ID 10422
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx123 (EcC030196.10)
Name (synonym) EcamPrx123 (EcC030196.10)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx123
start..stop
S start..stop
EglPrx123 664 0 1..329 1..329
EguPrx123 663 0 2..329 1..328
EgrPrx123 662 0 1..329 1..329
CmicPrx01 468 7e-168 9..329 5..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 1041..1232 192 N° 3 1925..2090 166 N° 4 2442..2845 404
join(1..228,1041..1232,1925..2090,2442..2845)


exon

Literature and cross-references EcamPrx123 (EcC030196.10)
Protein sequence: EcamPrx123 (EcC030196.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (301)
PWM (Da):   %s   36106.53 (33111.0) Transmb domain:   %s   i9-31o
PI (pH):   %s   9.87 (10.00) Peptide Signal:   %s   cut: 29 range:29-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMVMRSDRHSLILGCVLGFLVLLGGCHGGSLKKNFYKKSCPLAEEIVRNATWRHVAANIALPARFLRMHFHDCFVRGCDGSVLLNSTKNNTAEKEAIPNLTLAGFDFIDDIKAEVEKKCPGVVSCADILALAARDSVSFQFNRSMWEVLTGRRDGTVSLASEALANIPSPFLNFTALQQNFANKGLSVRDLVVLSGAHTIGVGHCNAFSVRLYNFTGKGDQDPSLNSTYAASLKNQCKNLTDNTTFVPMDPITPLSFDTRYFTVLRQRRGLFESDAALLTNPNSASITREMLNSRRFFKSFRTSIKRMGAISVLTGKSGEIRKVCSKIN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGTGATGAGGAGTGATCGACACTCATTGATTTTAGGGTGTGTTTTAGGGTTCCTTGTGTTGTTAGGAGGCTGCCATGGGGGGAGCCTGAAGAAGAACTTCTACAAGAAAAGCTGT
CCCTTGGCGGAGGAGATCGTGAGGAACGCAACGTGGAGGCATGTCGCGGCGAACATCGCACTGCCGGCGAGGTTCTTGAGGATGCATTTCCATGACTGCTTTGTTAGG
GTAAGCTTCCTT
GTTAATTACTCTTGACTCGTGTGATGACATAGATGCTTCGTTAGACTGCTCAGTTAGAGCAAGCGCAGTACATGTAACAACATAACCTTGGTCGATATTCGCCAAGGACCAGGCCGTCAT
GGTAGACCAATAGAGTTAAATCATGTATATCACATATCATATAAGAGCATACCCTAGAGCGTCATTTAGGATTCGTGTTCTAATAATCATTAGTACCCAAGGTTCACAATGCACTCATAA
CAATACTAAAGTTAGTCTCTCTTCCTCTCGATAGTCTTAATTTATAGATTAAAAATCATGTGAATTTGACATTGCGAGCCATGTGTAAATACCAACGAAAAAAAAAAGGGGGCGCAGTTC
TTAGCAATGTGACCTGCATTGTTAGTGAATTTTTCTCGCAAAACGAGGAGATGAGGCCAACATGCATTTAATCTCCACTAAATTGTAATTACCCTGTCGCGAAATCGAAATCACATATCC
ATTTAATTTTATCAATCCGTACATGAACGTGGGAATTAGAAAGTATACAAAACACCATCATTTATCGGACATGAGCCAAATAGTATTCTTTACGTAAAATTATCAACGCTACCTCTTTTA
GCCCAACCCACTTGTAATGTCGCTCATAAGGTCAAGACTGGTTGCTCATTATCATTATTTAACCAAAGATCGGTAAATGAGAGCATGTCGTCATGTACCTGTGTTGACCAATTTCTCATA
AGTGCACATTAGATCTACGAGAATGAATCGAGAAAAGGCAAATGAACAATGGCAATTTCATGGTTCCATGCAATTTCCAGGGATGTGACGGCTCAGTCTTGCTGAACTCGACCAAGAATA
ATACGGCGGAGAAGGAGGCAATCCCGAACCTCACGTTGGCGGGGTTTGATTTTATCGACGACATCAAAGCGGAGGTCGAGAAGAAGTGCCCGGGCGTCGTATCCTGCGCCGACATTTTGG
CTCTGGCCGCAAGGGACTCCGTTTCGTTCCAA
GTAAGTGCAAAAACATGTGAAGAAAGGAGCAAAGACAAATTCTTCTTTTCTAATCTAGAAGGATTTGTCAGAATTGACCATGCTAGGC
ATATATGAACACTTCTTTCTTCTTCTTTTTCAACACTTGGTATATCTAATGAATATACATGAACATAGGCACATCGACATAAGGATCGATTTTACTGTTCAGTCTGGGATTTGGATCCTC
TCGAATAATTAACTCATAAGTGAGCCATCTCCAGTCTTTCACGTGATACCCTGACATAAGGCAAAGAAGAGATCCAATGGCCAAAAAACCTGCTTTCCCATCTTCTCTCTTTCTTTTCCC
TGATTTCACACCGAGCAACCCCCTACCACCACCATCCACCATGGTGTCGGCGCCACTCTGTTGCCTCCTTGGCCCTCCACCTCCCTCCGTTTTCTCTGATTTTGTGCTCGATTTTTCATA
AGAAGGGGGGCATTTCGGTACTCCTAAAGCAAATAGACATGGCCGAGTTATGGACTTAATTGACAGGAGCCTAATCATAGTACCGGACATACGTGCACCTGTCCGACAACGCCATGCAAC
GTCGAAAACTTACATCTTTCTTGATCACGAGAGAAGCTACTTAAGCATGTAAACTCCATATCACAAATATCTCCCGCCAAACTCATTAGACTTTTCTTCATTCTCTTCTTGCATACTTTT
GCAGTTCAACAGGTCAATGTGGGAAGTGCTGACCGGAAGAAGAGACGGCACGGTGTCGCTAGCCTCCGAGGCCTTGGCCAACATCCCATCCCCTTTCCTCAACTTCACCGCCCTCCAACA
GAATTTCGCCAATAAAGGGCTAAGCGTGCGTGACCTTGTTGTTTTATCAG
GTACCGTAATTTCCTTACTAGCTCTCATGGGAAAAAGTTGCTCTCAAAAAAATTCCCGATCGAACCCGAA
AGTTGGGCTTTACACATGGATCGCGATAGCTGTAAGCAAATAGTTGCATCGAATCAACAACCAGATCGTAGAACAAAGACACGATAACGAGAAAAGAGAGAACCTCTCGCATCGGAGCTC
ATCAATTGACCCTGCCACTATGTTAGAAAGCCGCTAGCTTATGCCGAGAGCTTAAATTGCCCTCAAAAACAGGCTAATCACGTACATATTGAGCGTATTTGCGCGTTCTCTTAGTTTTTT
GTTCTGGACGAATAATAATGCTTTTCGAGTGGTGTTTAAAGGTGCGCACACAATAGGAGTAGGGCACTGCAACGCCTTCAGCGTAAGGCTCTACAACTTCACCGGAAAAGGCGACCAAGA
CCCATCCTTGAACTCCACCTACGCCGCCTCATTGAAGAACCAGTGCAAAAACCTCACCGACAACACCACCTTCGTGCCGATGGACCCAATCACCCCTCTCAGCTTCGACACTCGCTACTT
CACCGTCCTCAGACAGCGCAGGGGCCTCTTCGAATCCGACGCCGCGCTGCTCACGAACCCCAACTCGGCCAGTATCACTCGGGAGATGCTCAACTCGCGCAGGTTCTTCAAAAGTTTCAG
GACGTCCATCAAGAGGATGGGGGCGATCTCCGTCCTCACAGGGAAATCTGGGGAGATTAGGAAGGTCTGTAGTAAGATCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGTGATGAGGAGTGATCGACACTCATTGATTTTAGGGTGTGTTTTAGGGTTCCTTGTGTTGTTAGGAGGCTGCCATGGGGGGAGCCTGAAGAAGAACTTCTACAAGAAAAGCTGT
CCCTTGGCGGAGGAGATCGTGAGGAACGCAACGTGGAGGCATGTCGCGGCGAACATCGCACTGCCGGCGAGGTTCTTGAGGATGCATTTCCATGACTGCTTTGTTAGG
GGATGTGACGGC
TCAGTCTTGCTGAACTCGACCAAGAATAATACGGCGGAGAAGGAGGCAATCCCGAACCTCACGTTGGCGGGGTTTGATTTTATCGACGACATCAAAGCGGAGGTCGAGAAGAAGTGCCCG
GGCGTCGTATCCTGCGCCGACATTTTGGCTCTGGCCGCAAGGGACTCCGTTTCGTTCCAA
TTCAACAGGTCAATGTGGGAAGTGCTGACCGGAAGAAGAGACGGCACGGTGTCGCTAGCC
TCCGAGGCCTTGGCCAACATCCCATCCCCTTTCCTCAACTTCACCGCCCTCCAACAGAATTTCGCCAATAAAGGGCTAAGCGTGCGTGACCTTGTTGTTTTATCAG
GTGCGCACACAATA
GGAGTAGGGCACTGCAACGCCTTCAGCGTAAGGCTCTACAACTTCACCGGAAAAGGCGACCAAGACCCATCCTTGAACTCCACCTACGCCGCCTCATTGAAGAACCAGTGCAAAAACCTC
ACCGACAACACCACCTTCGTGCCGATGGACCCAATCACCCCTCTCAGCTTCGACACTCGCTACTTCACCGTCCTCAGACAGCGCAGGGGCCTCTTCGAATCCGACGCCGCGCTGCTCACG
AACCCCAACTCGGCCAGTATCACTCGGGAGATGCTCAACTCGCGCAGGTTCTTCAAAAGTTTCAGGACGTCCATCAAGAGGATGGGGGCGATCTCCGTCCTCACAGGGAAATCTGGGGAG
ATTAGGAAGGTCTGTAGTAAGATCAACTAA

Retrieve as FASTA