Entry information : EcamPrx22 ( EcC030597.20)
Entry ID 10423
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2016-03-17 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-17 (Achraf Jemmat)
Peroxidase information: EcamPrx22 ( EcC030597.20)
Name (synonym) EcamPrx22 ( EcC030597.20)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx22
start..stop
S start..stop
EcamPrx21 641 0 1..319 1..319
EgrPrx21 640 0 1..319 1..319
EglPrx21 640 0 1..319 1..319
EguPrx21 637 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..210 210 N° 2 1818..2003 186 N° 3 2127..2292 166 N° 4 2400..2785 386
join(1..210,1818..2003,2127..2292,2400..2785)


exon

Literature and cross-references EcamPrx22 ( EcC030597.20)
Protein sequence: EcamPrx22 ( EcC030597.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33247.38 (30551.0)  
PI (pH):   %s   8.15 (8.21) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARESSSVRSAFLLLLCFLLETASAQLSSTFYSTSCPSALSTIKSGVSSAVKSEARMGASLLRLHFHDCFVNGCDASVLLDDTANFTGEKNAGPNANSLRGFNVIDTIKSQLESACPGIVSCADLLTVAARDSVVALGGPSWTVPLGRRDSTTASQSAANSNIPAPTLSLSGLITAFSNKGFTAKEMLALSGSHTIGQARCTTFRTRLYNENNINATFATSLKANCPSSGGDNNLSPLDTTSPTSFDNAYFKNLQIQKGLLHSDQQLFSGGSTDAQVNAYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKSCGKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from Kazuza (splicing error of eintron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGAGAGCTCTTCTGTCAGATCCGCCTTCTTATTGTTGCTGTGTTTTCTTCTGGAAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTC
GTTAATGCAAGTCCCTCTGCCCGGAGTCTC
TCCTCTCTTTCCGATTGACTGCTACCTTTGTTACTCTTCTGTCATTCAAGCTGCATGCAAGCGTGCATGCAGGATGCATCTTTGTGCTTTTGTGCATGTGAAACGTTCCGACCGACCTCA
TAGTCAAAAAGAATGATTGGATTTCGCTTCTACGCAAGTTACTCTCTTTTTCACTAACCAAACAATAGGTAGGAAGCACACATATTGAATTAATCGAGTCTGACCGACCCTTTTTGTGCC
ATGCATTTTTGTGAGTTTATTATTATAATAGTACTAGGCTGTATTTATTGAAGTCGTTTTAAAATTAGAGCTATGTTTTCATTCAAACAGCAATAAAAAGCATGGCCCTTAGAATAAAAG
CACTTGTTTTTGGTGATTCAAAGAAAAAAATTTCATGAGAAATTCTAGTATGCACCGCTAGTGTAAAAATCTCATTCCGTAAGTGGTCTTATCTACTAGATATTTTGGTGGTTGGGGAGA
GATTTGGTAATTAGAATCCTCGAATCAAGATGGACAAGAATATTGTTGTGTGTGCTCTAATTTTTTTTTTTCATTTATTATATCGACAATGTAAGCCATGCAGGCGAGCGTGTTTTCTGC
CGAGTATTTTGTGGATAAGACGTGTTTGTGTATGATTAGCTACATGATTTTAAATTCGATGAATTAGATCACGCAAAAGTCCTAAACGTTGGAGATGGAAAAAAGAGAGAGCGACAGCCA
CGCTTTTATGACGGTGGTTGACTTTACGCGTTTATCATGTTTGGCAAATCAATCAGTTGTTTTCAATAGGTTTTGGTCTTATTTTGATCACCGTCGCCATACTTTTCTCCGTTGAAAATG
ATATTTTGCTATAAAATATCGTTTTTTTAATGAAATTTGTTAATCCAATAGAATTCTAAAAATTGTGTTAGATCTTTTGAACAATTTGAAGTACCTTCATTGTTATCCACTTCGTGTTCT
TTGATGATAATTCAAGAGTTGTCCATATCCTAATGGGCCTTTCTCCATCAAACATGCCGTCTCTATTTCAAACATGATATTTAAAGCCTGATCCATTTTTTACTAAAAAATGTGACATGT
TTACAACTTTCTCAATTAGATGCTTTTCTCTTTTCCTGTATGGGTTGGAAATTGTCTAGATCTTCAAGGTCATTCGAGAAGACAAAATTCAGGCTAATTCTAGTAAATCAAAAAGTCGGT
GACTCCCCTCTGTTAAATATTAAAGGACACGCCATGTTGCTAACCAAAAGCCTTGATTTAGAAAAACATCATAGCACAATCATTTTGTTTCTAGTCCGACAATTATTGGATGCATTATTT
CTAGAGAGACGACACAAATTGAAGTCAAAAGGCACGAGAAAGAGTGTCATTCCCGTCCAAACTGGTGTCTGCAGGCGTTCATAATGGGGGACAAAAGGGGGAAAATGATAAGGGAAATTA
ATCAGTGTTCATACTTTATGTTCAGGAAAAGTTATAGCACTCGTTCTGTTTATATTTTGACCGTTGAATCTAATGAATTCAATAGGATCGATTTGACTAATTAACGATGTGTGGCACAAA
ATATACAATAGGGATGCGACGCATCTGTTCTATTGGACGACACTGCAAACTTCACTGGGGAGAAGAATGCTGGCCCAAATGCCAATTCCTTACGGGGATTCAACGTGATTGACACAATCA
AATCCCAATTGGAGAGTGCATGCCCCGGCATCGTGTCCTGCGCTGATCTCTTGACCGTGGCTGCGCGAGATTCCGTCGTCGCT
GTAAGTGCACACTTTTTTTCTTAATTCCAGTGATCAA
TTGTGATGAGAAAAAATCACTCGTTATGATCTCGATGCCGCATCAATACTAACACGTGTGGATTTGTTTAACTATTTAATTCTTAGTTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAA
GAAGAGACTCAACCACTGCAAGCCAAAGTGCTGCTAATAGCAACATCCCTGCCCCGACTTTGAGCCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCGCCAAAGAAATGC
TGGCACTCTCAG
GTCATTGTTTTTCCTTTTTTGTGGCACCTTTTAATAACGAATTTACAATTATGCTTGATCGATATACTAAGATTAATATTAAAAAGTTGTTCGATTGTTGTTAACAGG
GTCGCACACGATAGGTCAAGCCCGATGCACAACTTTCCGGACCCGTCTTTACAACGAGAACAACATCAACGCCACGTTCGCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGCGA
CAACAATCTCTCTCCTCTAGACACCACGAGCCCGACGTCCTTCGACAATGCCTACTTTAAGAACTTGCAAATCCAGAAAGGTCTTCTTCACTCGGATCAGCAATTGTTTAGTGGTGGTTC
CACGGACGCTCAAGTGAACGCTTATAGCAGCAATTCAGCTACATTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAG
GAAGAGTTGCGGGAAAGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGAGAGCTCTTCTGTCAGATCCGCCTTCTTATTGTTGCTGTGTTTTCTTCTGGAAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCGGCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCACTTCCACGATTGCTTC
GACGCATCTGTTCTATTGGACGACACTGCA
AACTTCACTGGGGAGAAGAATGCTGGCCCAAATGCCAATTCCTTACGGGGATTCAACGTGATTGACACAATCAAATCCCAATTGGAGAGTGCATGCCCCGGCATCGTGTCCTGCGCTGAT
CTCTTGACCGTGGCTGCGCGAGATTCCGTCGTCGCT
TTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAAGAAGAGACTCAACCACTGCAAGCCAAAGTGCTGCTAATAGCAACATCCCT
GCCCCGACTTTGAGCCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCGCCAAAGAAATGCTGGCACTCTCAG
GGTCGCACACGATAGGTCAAGCCCGATGCACAACTTTC
CGGACCCGTCTTTACAACGAGAACAACATCAACGCCACGTTCGCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGCGACAACAATCTCTCTCCTCTAGACACCACGAGCCCGACG
TCCTTCGACAATGCCTACTTTAAGAACTTGCAAATCCAGAAAGGTCTTCTTCACTCGGATCAGCAATTGTTTAGTGGTGGTTCCACGGACGCTCAAGTGAACGCTTATAGCAGCAATTCA
GCTACATTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAAGAGTTGCGGGAAAGTCAACTAA

Retrieve as FASTA