Entry information : OsPrx34
Entry ID 1044
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx34
Name OsPrx34
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Pannicles
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx34
start..stop
S start..stop
BdiPrx48 444 5e-158 25..322 28..338
SofPrx03 384 1e-134 21..322 26..330
MtPrx07 384 2e-134 11..322 11..326
MePrx120 380 6e-133 11..322 13..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1159554..1159766 213 N° 2 1159250..1159438 189 N° 3 1159012..1159177 166 N° 4 1158306..1158706 401
complement(join(1158306..1158706,1159012..1159177,1159250..1159438,1159554..1159 766))


exon

Literature and cross-references OsPrx34
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q8LMR6
DNA ref. GenBank:   NC_008396.1 (1159766..1158309)
Protein sequence: OsPrx34
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (298)
PWM (Da):   %s   33343.42 (31107.2)  
PI (pH):   %s   6.01 (6.34) Peptide Signal:   %s   cut: 25 range:25-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELVVAVAGAVVVALSLCIGGVQGQLQVGFYDQSCPQAEVIVRDEVGKAVSANVGLAAGLVRMHFHDCFVKGCDASVLLDSTANSTAEKDAIPNKSLRGFEVVDSAKRRLESACKGVVSCADILAFAARDSVVLAGGTPYRVPAGRRDGNTSVASDAMANLPRPTSDVAQLTQSFATHGLSQDDMVILSGAHTIGVAHCSSFSSRLYGYNSSTGQDPALNAAMASRLSRSCPQGSANTVAMDDGSENTFDTSYYQNLLAGRGVLASDQTLTADNATAALVAQNAYNMYLFATKFGQAMVKMGAIQVLTGSDGQIRTNCRVAN

Retrieve as FASTA  
Remarks chromosome 3. 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTGGTGGTGGCGGTAGCAGGTGCAGTAGTCGTGGCACTGAGCTTGTGCATTGGAGGTGTGCAAGGTCAGCTCCAGGTAGGGTTCTACGACCAATCGTGCCCCCAGGCCGAAGTG
ATTGTGAGAGACGAGGTCGGCAAGGCCGTGAGCGCCAACGTTGGCCTCGCCGCCGGCCTTGTCCGGATGCACTTCCATGACTGCTTCGTCAAG
GTCGATCCCAATAAACCAATCTCTAAT
TCGATCTCTCCTTTATATTGTTCAATTCATTCCGGGGAAATGGGATCAATCAGCTGATCGAGATGGTTGATCGATGAACTGTTTTTAGGGATGTGACGCGTCGGTTTTGCTGGATTCGAC
GGCGAACAGCACGGCGGAGAAGGACGCGATACCGAACAAGAGCCTGAGGGGGTTCGAGGTGGTGGACAGCGCCAAGCGGCGGCTGGAGAGCGCGTGCAAGGGGGTGGTCTCCTGCGCGGA
CATACTCGCCTTCGCCGCCAGAGACAGCGTCGTGCTG
GTACGCAGCTAGCTCTTTCACGGTGGCTGCGAATTTGTTTTTAACTTGCATACGGTCGGTGGTGGACGGCAGGCCGGCGGCAC
CCCGTACCGCGTTCCGGCCGGGAGGAGGGACGGCAACACCTCCGTGGCGTCCGACGCGATGGCCAACCTGCCCCGTCCCACCTCAGATGTGGCCCAACTCACACAAAGTTTCGCCACTCA
TGGGCTTTCCCAGGACGACATGGTCATCCTTTCAG
GTACAGGTCCATATAAAAGCCCACATAGGTCAACTTGTTAATGACAGCCCACTATTCAATTCAGCCCAACTTCTGGAATTCTCAT
AAGGCCCAGGCGAATAGGCAATAAATTAAGAACTTATTAGCCCCACAAATAATCTAATCTAAAATTCGCTGTTAGTTTGAACTCAAGATATTAGAATGGTACTTAAGTCACTATAAATAT
TAGGCTACATGCATATCCACCACTCTTCTTCTCGAAAAGATTTATTTTTTTCTTTTTTTTAACAAACAATATTTTTCTCTCTGTGTTTTTTTTTAATCAGGGGCGCACACGATAGGGGTG
GCGCATTGCAGCTCGTTCAGCTCGAGGCTGTACGGGTACAACTCCAGCACGGGGCAGGACCCGGCGCTGAACGCGGCGATGGCGTCGCGGCTGTCGCGGAGTTGCCCGCAGGGGAGCGCC
AACACGGTGGCCATGGACGACGGCAGCGAGAACACGTTCGACACCAGCTACTACCAGAACCTCCTCGCCGGCCGCGGCGTCCTCGCCTCCGACCAGACGCTCACCGCCGACAACGCCACC
GCCGCGCTCGTGGCGCAGAACGCCTACAACATGTACCTCTTCGCCACCAAGTTCGGCCAGGCCATGGTCAAGATGGGCGCCATCCAGGTGCTCACCGGCAGCGACGGCCAGATCCGCACA
AACTGCAGGGTTGCAAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTGGTGGTGGCGGTAGCAGGTGCAGTAGTCGTGGCACTGAGCTTGTGCATTGGAGGTGTGCAAGGTCAGCTCCAGGTAGGGTTCTACGACCAATCGTGCCCCCAGGCCGAAGTG
ATTGTGAGAGACGAGGTCGGCAAGGCCGTGAGCGCCAACGTTGGCCTCGCCGCCGGCCTTGTCCGGATGCACTTCCATGACTGCTTCGTCAAG
GGATGTGACGCGTCGGTTTTGCTGGAT
TCGACGGCGAACAGCACGGCGGAGAAGGACGCGATACCGAACAAGAGCCTGAGGGGGTTCGAGGTGGTGGACAGCGCCAAGCGGCGGCTGGAGAGCGCGTGCAAGGGGGTGGTCTCCTGC
GCGGACATACTCGCCTTCGCCGCCAGAGACAGCGTCGTGCTG
GCCGGCGGCACCCCGTACCGCGTTCCGGCCGGGAGGAGGGACGGCAACACCTCCGTGGCGTCCGACGCGATGGCCAAC
CTGCCCCGTCCCACCTCAGATGTGGCCCAACTCACACAAAGTTTCGCCACTCATGGGCTTTCCCAGGACGACATGGTCATCCTTTCAG
GGGCGCACACGATAGGGGTGGCGCATTGCAGC
TCGTTCAGCTCGAGGCTGTACGGGTACAACTCCAGCACGGGGCAGGACCCGGCGCTGAACGCGGCGATGGCGTCGCGGCTGTCGCGGAGTTGCCCGCAGGGGAGCGCCAACACGGTGGCC
ATGGACGACGGCAGCGAGAACACGTTCGACACCAGCTACTACCAGAACCTCCTCGCCGGCCGCGGCGTCCTCGCCTCCGACCAGACGCTCACCGCCGACAACGCCACCGCCGCGCTCGTG
GCGCAGAACGCCTACAACATGTACCTCTTCGCCACCAAGTTCGGCCAGGCCATGGTCAAGATGGGCGCCATCCAGGTGCTCACCGGCAGCGACGGCCAGATCCGCACAAACTGCAGGGTT
GCAAACTGA

Retrieve as FASTA