Entry information : OsPrx35
Entry ID 1045
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx35
Name OsPrx35
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx35
start..stop
S start..stop
SiPrx171 544 0 4..319 1..316
CclPrx110 394 1e-138 12..319 25..328
CsPrx21 390 3e-137 12..319 25..328
StPrx23 390 3e-137 12..319 22..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1171332..1171511 180 N° 2 1170481..1171260 780  
complement(join(1170481..1171260,1171332..1171511))


exon

Literature and cross-references OsPrx35
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q8LMR4
DNA ref. GenBank:   NC_008396.1 (1171511..1170484)
Protein sequence: OsPrx35
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319
PWM (Da):   %s   33510.61  
PI (pH):   %s   5.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIVCAGFPANDGSLHPNFYAATCPQAETIVRQEVTRALYTNIGFAAGLVRMHFHDCFVRGCDGSVLLESTSDNVAERDSPINNPSLRGFEVIDAAKARLEAACPGVVSCADVLAYAARDGVALTGGPRYDVPGGRRDGTASLEPEVADNIPAPTFTLDQLTQSFAAKGLTQEEMVTLSGAHTVGRAHCTSFSDRLYNFSATGAADPSVDPALLPQLRRACPAAGPDGAVDAGLVVPMEPRTPNGFDALYYWAVLRNRALFTSDQALLSSPPTAAQVRQTAYGGYPWKLKFAAAMVKMGQIEVLTGGSGEIRTKCSAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATCGTGTGTGCCGGTTTCCCTGCCAACGATGGGTCACTGCACCCCAACTTCTACGCGGCGACGTGCCCGCAGGCGGAGACCATCGTTCGCCAGGAGGTCACCCGGGCCCTCTAC
ACCAACATCGGCTTCGCTGCCGGCCTCGTCCGCATGCACTTCCACGACTGCTTCGTCAGG
GTACGCACGCACGCGAATTAATTCACCATGCAATGCATCATGCAAAATGGATTATCCATC
CATGCATGCAGGGGTGCGACGGGTCGGTGCTGCTGGAGTCGACGTCGGACAACGTCGCGGAGAGGGACTCGCCGATCAACAACCCGAGCCTACGCGGCTTCGAGGTCATCGACGCCGCCA
AGGCTCGGCTGGAGGCCGCCTGCCCAGGCGTCGTCTCCTGCGCCGACGTCCTCGCCTACGCCGCCAGGGACGGCGTCGCGCTCACCGGGGGCCCCCGCTACGACGTCCCGGGCGGCCGGA
GGGACGGCACGGCGTCGCTCGAGCCGGAGGTGGCGGACAACATCCCGGCTCCGACGTTCACGCTGGACCAGCTCACCCAGAGCTTCGCCGCCAAGGGCCTCACACAGGAGGAGATGGTCA
CCCTGTCCGGCGCGCACACCGTCGGCCGCGCGCACTGCACGTCGTTCAGCGACCGCCTCTACAACTTCAGCGCGACGGGCGCCGCCGACCCCAGCGTCGACCCGGCGTTGCTGCCGCAGC
TCCGCCGCGCGTGCCCGGCCGCGGGACCCGACGGCGCCGTGGACGCCGGCCTCGTCGTGCCCATGGAGCCCCGCACGCCCAACGGCTTCGACGCGCTCTACTACTGGGCCGTGCTACGCA
ACCGCGCCCTCTTCACCTCCGACCAGGCGCTGCTGTCCAGCCCGCCCACCGCCGCGCAGGTCAGGCAGACCGCGTACGGCGGGTACCCGTGGAAGCTCAAGTTCGCCGCCGCCATGGTGA
AGATGGGGCAGATCGAGGTGCTCACCGGCGGCAGCGGCGAGATCAGGACCAAGTGCAGCGCCGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATCGTGTGTGCCGGTTTCCCTGCCAACGATGGGTCACTGCACCCCAACTTCTACGCGGCGACGTGCCCGCAGGCGGAGACCATCGTTCGCCAGGAGGTCACCCGGGCCCTCTAC
ACCAACATCGGCTTCGCTGCCGGCCTCGTCCGCATGCACTTCCACGACTGCTTCGTCAGG
GGGTGCGACGGGTCGGTGCTGCTGGAGTCGACGTCGGACAACGTCGCGGAGAGGGACTCG
CCGATCAACAACCCGAGCCTACGCGGCTTCGAGGTCATCGACGCCGCCAAGGCTCGGCTGGAGGCCGCCTGCCCAGGCGTCGTCTCCTGCGCCGACGTCCTCGCCTACGCCGCCAGGGAC
GGCGTCGCGCTCACCGGGGGCCCCCGCTACGACGTCCCGGGCGGCCGGAGGGACGGCACGGCGTCGCTCGAGCCGGAGGTGGCGGACAACATCCCGGCTCCGACGTTCACGCTGGACCAG
CTCACCCAGAGCTTCGCCGCCAAGGGCCTCACACAGGAGGAGATGGTCACCCTGTCCGGCGCGCACACCGTCGGCCGCGCGCACTGCACGTCGTTCAGCGACCGCCTCTACAACTTCAGC
GCGACGGGCGCCGCCGACCCCAGCGTCGACCCGGCGTTGCTGCCGCAGCTCCGCCGCGCGTGCCCGGCCGCGGGACCCGACGGCGCCGTGGACGCCGGCCTCGTCGTGCCCATGGAGCCC
CGCACGCCCAACGGCTTCGACGCGCTCTACTACTGGGCCGTGCTACGCAACCGCGCCCTCTTCACCTCCGACCAGGCGCTGCTGTCCAGCCCGCCCACCGCCGCGCAGGTCAGGCAGACC
GCGTACGGCGGGTACCCGTGGAAGCTCAAGTTCGCCGCCGCCATGGTGAAGATGGGGCAGATCGAGGTGCTCACCGGCGGCAGCGGCGAGATCAGGACCAAGTGCAGCGCCGTCAACTGA

Retrieve as FASTA