Entry information : EgrPrx117
Entry ID 10468
Creation 2012-02-07 (Qiang Li)
Last sequence changes 2012-02-13 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-13 (Christophe Dunand)
Peroxidase information: EgrPrx117
Name EgrPrx117
Class Class III peroxidase    [Orthogroup: Prx213]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx117
start..stop
S start..stop
EguPrx117 652 0 1..326 1..326
EglPrx117 622 0 14..326 14..325
EcamPrx114 478 1e-171 8..326 5..322
EgrPrx114 473 1e-169 8..326 5..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49738855..49739085 231 N° 2 49739461..49739659 199 N° 3 49739754..49739912 159 N° 4 49740010..49740401 392
join(49738855..49739085,49739461..49739659,49739754..49739912,49740010..49740401 )


exon

Literature and cross-references EgrPrx117
DNA ref. Phytozome 12:   scaffold_7 (49738855..49740401)
Protein sequence: EgrPrx117
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (296)
PWM (Da):   %s   35224.9 (32320.4) Transmb domain:   %s   i13-35o
PI (pH):   %s   7.66 (7.31) Peptide Signal:   %s   cut: 31 range:31-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSTASSSFSKAVLSFACVLVLISASTSAQLSLDYYSRSCPVLFPTVRLIVGAAIAREARMGASLLRLFFHDCFVNGCDGSLLLDDTPTFTGEKNAAPNVNSARGFEVVDQVKSAVEGVCPGIVSCADLLAIIARDSVVIVSWPWWPVKLGRRDARSASQAAANESIPRPTSDLNELISSFRNVGLNIRDLVALAGGHTIGLSRCTNFRDRVYNETNIDVLLAQTRKFGCPGIDGVDDDNLAPLDFQTPITFDHSYYSNLVQRRGLLHSDQQLFNGGPTDSFVRLYSRSPLAFQGDFVASITRMGDIKPLTGSNGEIRRNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTCAACCGCTAGTTCTTCGTTTTCAAAGGCCGTTTTGAGTTTCGCTTGCGTTTTGGTCTTGATCAGTGCAAGCACGAGCGCGCAGCTTTCCCTCGACTATTATTCCAGATCT
TGCCCCGTCCTCTTCCCCACGGTGAGGCTGATCGTGGGAGCCGCTATAGCGAGGGAGGCTCGGATGGGCGCCTCACTGCTTCGCCTGTTCTTCCATGATTGCTTCGTCAAT
GTAACTTTC
ACCCCCCTCCAATCTTTTTTCACCTTCTGGAATCTTTCCACGCACATTCTTCTAACTCTGCACTCATCGCGCTCGTATGTGCAACCAGCATCATGCGATAGAGTTTATAACCAGTTCGCT
TGGGGTAATTCTTTTCATGATCCAATACTATGCAATGTGTTCACAGTTACTCAAATGGTTGTTCGTCGTTCAAAGTAGCAAGAGCTCAACATCTAGTCCATTGTCCCAAGGTCATAAGGA
ATTGAATATGAAAGCCTGAACTACTATTAATCTTAATGTGGCGCCTTTTAGCAAACATACTGCGAACCTATAGCTGACGGAATACGTATTACTGTTGAAACGCATTTGATATCGGCGTTG
TATCAGGGCTGCGACGGATCACTTCTTCTGGATGATACACCTACCTTCACTGGAGAGAAAAACGCCGCTCCAAATGTCAATTCAGCGCGAGGGTTCGAAGTGGTCGACCAAGTTAAGTCC
GCCGTGGAGGGGGTGTGTCCAGGCATCGTCTCGTGTGCCGATCTGTTGGCGATTATTGCACGAGACTCCGTCGTGATCGTGAGCT
GTTTGAATTTGGCTAGCAATTAATATACAATTAAT
AGAGATTTGGCGATGTTCTAATTTAGTTCCCTTGGACTATCATGCATGACAGCTTGGAGGGCCATGGTGGCCAGTGAAGCTGGGAAGAAGAGATGCTAGAAGCGCAAGCCAAGCAGCTGC
TAATGAGAGCATCCCCCGGCCGACGTCCGACCTCAACGAATTAATCTCCTCGTTCCGAAATGTCGGTCTCAACATCAGGGACCTCGTGGCTTTAGCAG
GTAACTAAAATTGGAATTTATC
TCGCATAATCGAATCAGAAAGATGAGATCGAGAGCTCGTTCAATTTGATACATATTTTTTTCGCGCCATTTCAAGGAGGCCACACGATCGGACTATCAAGATGCACGAACTTCAGGGACC
GGGTCTACAACGAGACCAACATCGACGTGCTGTTGGCCCAAACGAGGAAGTTCGGCTGCCCTGGCATCGACGGCGTGGACGACGACAATCTGGCCCCGCTCGACTTCCAGACCCCGATAA
CGTTCGACCACAGCTACTACTCCAACCTCGTCCAGAGGCGCGGCCTTCTCCACTCGGACCAGCAGCTCTTCAACGGCGGGCCCACCGACTCGTTCGTGAGGCTCTATAGCAGAAGCCCGC
TCGCCTTCCAGGGGGACTTCGTGGCCTCCATCACGAGGATGGGCGACATCAAGCCCCTCACCGGATCCAACGGTGAGATTCGGAGGAACTGCAGGAGGGTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTCAACCGCTAGTTCTTCGTTTTCAAAGGCCGTTTTGAGTTTCGCTTGCGTTTTGGTCTTGATCAGTGCAAGCACGAGCGCGCAGCTTTCCCTCGACTATTATTCCAGATCT
TGCCCCGTCCTCTTCCCCACGGTGAGGCTGATCGTGGGAGCCGCTATAGCGAGGGAGGCTCGGATGGGCGCCTCACTGCTTCGCCTGTTCTTCCATGATTGCTTCGTCAAT
GGCTGCGAC
GGATCACTTCTTCTGGATGATACACCTACCTTCACTGGAGAGAAAAACGCCGCTCCAAATGTCAATTCAGCGCGAGGGTTCGAAGTGGTCGACCAAGTTAAGTCCGCCGTGGAGGGGGTG
TGTCCAGGCATCGTCTCGTGTGCCGATCTGTTGGCGATTATTGCACGAGACTCCGTCGTGATCGTGAGCT
GGCCATGGTGGCCAGTGAAGCTGGGAAGAAGAGATGCTAGAAGCGCAAGC
CAAGCAGCTGCTAATGAGAGCATCCCCCGGCCGACGTCCGACCTCAACGAATTAATCTCCTCGTTCCGAAATGTCGGTCTCAACATCAGGGACCTCGTGGCTTTAGCAG
GAGGCCACACG
ATCGGACTATCAAGATGCACGAACTTCAGGGACCGGGTCTACAACGAGACCAACATCGACGTGCTGTTGGCCCAAACGAGGAAGTTCGGCTGCCCTGGCATCGACGGCGTGGACGACGAC
AATCTGGCCCCGCTCGACTTCCAGACCCCGATAACGTTCGACCACAGCTACTACTCCAACCTCGTCCAGAGGCGCGGCCTTCTCCACTCGGACCAGCAGCTCTTCAACGGCGGGCCCACC
GACTCGTTCGTGAGGCTCTATAGCAGAAGCCCGCTCGCCTTCCAGGGGGACTTCGTGGCCTCCATCACGAGGATGGGCGACATCAAGCCCCTCACCGGATCCAACGGTGAGATTCGGAGG
AACTGCAGGAGGGTTAATTGA

Retrieve as FASTA