Entry information : EgrPrx167
Entry ID 10479
Creation 2012-02-08 (Qiang Li)
Last sequence changes 2012-08-22 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-24 (Christophe Dunand)
Peroxidase information: EgrPrx167
Name EgrPrx167
Class Class III peroxidase    [Orthogroup: Prx101]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx167
start..stop
S start..stop
EguPrx167 642 0 1..320 1..320
EcamPrx200 546 0 1..320 1..320
EgrPrx169 544 0 1..320 1..320
EcamPrx188 527 0 1..320 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..219 219 N° 2 880..1071 192 N° 3 1203..1754 552  
join(1..219,880..1071,1203..1754)


exon

Literature and cross-references EgrPrx167
DNA ref. Phytozome 11:   scaffold_11 (15885446..15887199)
Protein sequence: EgrPrx167
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (295)
PWM (Da):   %s   34123.84 (31351.4)  
PI (pH):   %s   7.26 (6.87) Peptide Signal:   %s   cut: 26 range:26-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFDTALKISFLFVVCVITSRSASAQLSNQNYYEKGCPKALQTIGSAVKSAVANESRMGASLLRLHFHDCFVNGCDGSILLDDTANFTGEKTAFPNLNSLRGFDVVDTIKSEVEKLCPGVVSCADILAIVARDSVVELGGQSWQVQLGRRDSTTASLNTANTDLPAPTLNLSALITSFSNKGFTAEEMVTLSGSHTIGQSRCVTFRARLYNESNIDSSFATTLKANCPSSGGDNNLSPLDVTSPTSFDNAYFTNLVCQKGLLHSDQQLFSGGSTNAQVTAYSKNFGSFQNDFAKAMVKMGGLSPLTGSTGQIRTNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No prediction from phytozome. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCGATACAGCCCTGAAAATCAGCTTCCTTTTCGTTGTTTGCGTGATCACGTCGAGATCTGCCTCGGCACAGTTGTCTAACCAAAATTACTACGAGAAAGGGTGCCCGAAAGCA
CTCCAGACCATTGGATCTGCCGTGAAATCGGCAGTGGCCAATGAGTCCCGCATGGGAGCATCCTTGCTCCGTCTTCACTTCCATGATTGCTTCGTCAAT
GCAAGTCTCATTCGCTTTCTC
ACTCTGCTCTATGTTTTTCACTTCCACGTCCATTTTCATTCTTTTGTGCATGTGTTGCATGTTCTTTTATGTGCGAGCTTTTACTTCATTCCCGATCCATACATGGATTATTCCTTTATG
TGTATTTTCGATTGATCATCCATTCCTGCTTCGCTAAAAACAATTTTGACGTCCGATGTTAGAAGAGTTGCAAAACAACATTGTTTTTTTTTCCTTCATCTTTTTCCATTTTATTATCTT
GCGTTGGTTATATAATTCCACGCATGTCACACACATCAGTGAGTACAACCCATTTAGTAGGAAAAGATGTGACCAACATTTTGGAAATTCGAATTTTTAAGGAATACTGCAACAACTGAG
ATACAAGGGCCAACGATTCCATTAAATTAAGAAAGAACAGACATTGAGCTGACCATAGCACACCCCTGCCAACCTGGTGTCTCTAACTTCGTCTTTTCTCCCCCTTTTTTTTTAAAGGAA
AGGTCTCTCTTTTAACATTCCTTTCCGATTGTTCGTAAGGGAAAAAACACTATTTTGTTTCCTCATAAATTCAATATTTAGATCATCCTTTCTGCTTCGTTGGATCTTGTAAACCTAATA
AGATGAAATATTGATGTTCTTTTTAATTTTTTTTTACAGGGTTGTGATGGATCAATTCTACTAGATGACACCGCGAACTTTACTGGGGAGAAGACGGCGTTTCCCAACTTGAACTCCTTG
AGGGGATTCGATGTGGTTGACACCATCAAGTCAGAAGTGGAAAAACTGTGCCCTGGTGTCGTCTCGTGCGCTGACATCTTAGCCATTGTTGCGAGAGATTCCGTCGTCGAA
GTAAGCACC
CAACTCTTGAGATTTCTTAGAACGTAATTTTATTATTAATATCTCAGAATATTCTTTTGAATTGATATGAAGAAAATTTGAGTTTCCTAATCTTACGTGGATTCATTAAATTTGATTTTC
AGTTGGGGGGACAGAGTTGGCAAGTTCAACTAGGAAGAAGAGATTCAACCACGGCGAGCCTGAACACTGCTAATACTGACCTCCCAGCTCCAACTCTTAATCTTAGTGCCCTAATCACTT
CTTTCTCTAACAAAGGCTTCACTGCCGAAGAAATGGTAACCCTCTCAGGATCTCACACCATAGGCCAATCCAGGTGCGTGACATTCCGGGCCCGTCTTTACAACGAAAGCAACATAGACT
CGTCGTTCGCCACAACTTTAAAAGCCAATTGCCCTAGCTCGGGAGGTGACAACAACCTCTCCCCTCTTGACGTCACCAGCCCGACGTCCTTCGACAATGCCTACTTCACCAACTTGGTGT
GCCAAAAGGGTTTGCTTCATTCGGACCAGCAATTGTTCAGTGGAGGTTCGACGAATGCTCAAGTGACTGCCTACAGCAAGAACTTTGGCTCGTTCCAGAATGATTTTGCCAAGGCCATGG
TCAAGATGGGTGGCCTTAGCCCTCTCACCGGGTCCACTGGTCAAATCAGGACGAATTGTAGAAGAGTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCGATACAGCCCTGAAAATCAGCTTCCTTTTCGTTGTTTGCGTGATCACGTCGAGATCTGCCTCGGCACAGTTGTCTAACCAAAATTACTACGAGAAAGGGTGCCCGAAAGCA
CTCCAGACCATTGGATCTGCCGTGAAATCGGCAGTGGCCAATGAGTCCCGCATGGGAGCATCCTTGCTCCGTCTTCACTTCCATGATTGCTTCGTCAAT
GGTTGTGATGGATCAATTCTA
CTAGATGACACCGCGAACTTTACTGGGGAGAAGACGGCGTTTCCCAACTTGAACTCCTTGAGGGGATTCGATGTGGTTGACACCATCAAGTCAGAAGTGGAAAAACTGTGCCCTGGTGTC
GTCTCGTGCGCTGACATCTTAGCCATTGTTGCGAGAGATTCCGTCGTCGAA
TTGGGGGGACAGAGTTGGCAAGTTCAACTAGGAAGAAGAGATTCAACCACGGCGAGCCTGAACACTGCT
AATACTGACCTCCCAGCTCCAACTCTTAATCTTAGTGCCCTAATCACTTCTTTCTCTAACAAAGGCTTCACTGCCGAAGAAATGGTAACCCTCTCAGGATCTCACACCATAGGCCAATCC
AGGTGCGTGACATTCCGGGCCCGTCTTTACAACGAAAGCAACATAGACTCGTCGTTCGCCACAACTTTAAAAGCCAATTGCCCTAGCTCGGGAGGTGACAACAACCTCTCCCCTCTTGAC
GTCACCAGCCCGACGTCCTTCGACAATGCCTACTTCACCAACTTGGTGTGCCAAAAGGGTTTGCTTCATTCGGACCAGCAATTGTTCAGTGGAGGTTCGACGAATGCTCAAGTGACTGCC
TACAGCAAGAACTTTGGCTCGTTCCAGAATGATTTTGCCAAGGCCATGGTCAAGATGGGTGGCCTTAGCCCTCTCACCGGGTCCACTGGTCAAATCAGGACGAATTGTAGAAGAGTCAAT
TGA

Retrieve as FASTA