Entry information : EgrPrx55
Entry ID 10487
Creation 2012-02-09 (Qiang Li)
Last sequence changes 2016-01-18 (Achraf Jemmat)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-19 (Christophe Dunand)
Peroxidase information: EgrPrx55
Name EgrPrx55
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx55
start..stop
S start..stop
EglPrx55 662 0 1..333 1..333
EguPrx55 660 0 1..333 1..333
EcamPrx55 644 0 1..333 1..332
MePrx53 521 0 3..333 5..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35289437..35289661 225 N° 2 35289800..35289985 186 N° 3 35290114..35290285 172 N° 4 35290640..35291058 419
join(35289437..35289661,35289800..35289985,35290114..35290285,35290640..35291058 )


exon

Literature and cross-references EgrPrx55
DNA ref. Phytozome 11:   scaffold_1 (35289437..35291058)
Protein sequence: EgrPrx55
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (305)
PWM (Da):   %s   34821.02 (31916.5)  
PI (pH):   %s   5.16 (4.58) Peptide Signal:   %s   cut: 29 range:29-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVRSHAPSSLMGIAVFAALLFLLHPSSAQLSSNFYATSCPNVSNIVQTVIQQALQSDPRITASLLRLHFHDCFVDGCDGSLLLDNSATITSEKDAAPNTNSTRGFDVVDNIKSAIESSCPGTVSCADILALGAQASVLQSGGPSWTVLSGRRDSLTANQAGANTSIPSPFDSLANLTSKFAAVGLDTNDLVTLSGAHTFGRAQCRTFSPRLYNFNASGSPDPTISPSYLTTLQQLCPQNGSGSVLANLDPTTVNTFDNNYYANLQNNQGLLQSDQELFSTSGAATISIVNSFSGNQSAFFQSFAQSMINMGNISPLTGSSGEIRSNCKKVNGS

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCCGTTCTCACGCTCCTTCCTCGCTGATGGGGATAGCGGTTTTCGCCGCGTTGTTGTTTCTCCTCCATCCGTCGAGTGCTCAATTAAGCTCAAACTTTTATGCCACATCATGCCCG
AATGTGTCCAACATCGTCCAAACCGTGATCCAGCAGGCCCTTCAATCCGACCCGCGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTTGTTGAC
GTGAGTCCCTAAGCT
TGGTCTTGGTCAACTCCCGTTAACAGCGTGTCCTAAATTAAGCGTTTTTCGTTTTGACTTTCAATCCGATTATCGGGTAGTTGGTCACTTGAACTAACTTTTGAGCATACTATGTGTTGA
CAGGGGTGTGATGGATCGTTGTTGCTGGACAACAGCGCAACCATTACGAGTGAGAAAGACGCAGCTCCGAATACAAATTCGACAAGAGGGTTCGATGTGGTGGACAACATCAAATCAGCC
ATCGAGAGCTCTTGTCCTGGGACCGTGTCTTGCGCCGACATTCTCGCCCTCGGTGCTCAAGCTTCTGTC
GTTCTGGTAGACATAGCTATAGTCAAAGAAACTTTAAATATAAATTCAAAG
CATATCTAGGGTTGGCTACTGATACTTGGCTTCCACGAATCATAATGGTGCTTCTCTTGATTGTCACTCTTATAAACTTGCAGTCAGGAGGTCCATCTTGGACGGTGCTCTCGGGGAGGA
GGGACAGCTTGACGGCGAACCAAGCAGGAGCGAACACATCGATACCTAGCCCTTTTGATTCCTTGGCTAACCTCACTTCCAAATTCGCCGCTGTTGGCTTGGACACCAATGACCTTGTCA
CTCTTTCCG
GTAAAGAACCACAGACAAAAAGAAGAGCTAAAGTGTATTGTTGGACTTGCATATGAAGATCCAAAGGATGGTGTCAAAATTTGCATACAAACTCCTAGATTTATATGCTAA
ATGATAAGTTTACTAAGGTCGTTTTAAATTAATATATCAAGTAACATTGTAGATGGCAATTATTTTACATTTAACGTGACCCACTTACTCAGATGCATCCTACTGAATTTGTCACATTTA
TTTGGTATACAACTTATTTTAAGCATACCTAGCATTGCTCTATTCATCGACTTCCATAACTGAGCATTTGCAGATTCTTTGTTCTGCCTCAGCTAACTTTTCGTGCATCTGATCATGAAA
CAGGAGCTCACACCTTTGGACGTGCACAGTGCAGGACATTCAGCCCTAGGCTCTACAACTTCAACGCGAGTGGCAGCCCAGATCCAACCATAAGTCCTTCATACTTGACCACTCTCCAAC
AACTTTGCCCACAGAATGGAAGCGGCTCCGTCCTCGCCAACCTCGACCCGACGACCGTGAACACATTCGACAACAACTACTACGCCAACCTCCAGAACAACCAAGGGCTTCTTCAGTCCG
ATCAAGAGCTGTTCTCAACATCTGGCGCCGCAACGATCTCCATCGTCAACAGCTTCAGCGGCAACCAGAGCGCCTTCTTCCAGAGCTTTGCTCAATCGATGATAAACATGGGAAACATTA
GTCCTCTCACCGGAAGTAGTGGGGAGATCAGATCGAATTGCAAGAAGGTCAACGGGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCCGTTCTCACGCTCCTTCCTCGCTGATGGGGATAGCGGTTTTCGCCGCGTTGTTGTTTCTCCTCCATCCGTCGAGTGCTCAATTAAGCTCAAACTTTTATGCCACATCATGCCCG
AATGTGTCCAACATCGTCCAAACCGTGATCCAGCAGGCCCTTCAATCCGACCCGCGCATCACCGCCAGCCTCCTCCGTCTCCATTTCCACGATTGCTTTGTTGAC
GGGTGTGATGGATCG
TTGTTGCTGGACAACAGCGCAACCATTACGAGTGAGAAAGACGCAGCTCCGAATACAAATTCGACAAGAGGGTTCGATGTGGTGGACAACATCAAATCAGCCATCGAGAGCTCTTGTCCT
GGGACCGTGTCTTGCGCCGACATTCTCGCCCTCGGTGCTCAAGCTTCTGTC
TTGCAGTCAGGAGGTCCATCTTGGACGGTGCTCTCGGGGAGGAGGGACAGCTTGACGGCGAACCAAGCA
GGAGCGAACACATCGATACCTAGCCCTTTTGATTCCTTGGCTAACCTCACTTCCAAATTCGCCGCTGTTGGCTTGGACACCAATGACCTTGTCACTCTTTCCG
GAGCTCACACCTTTGGA
CGTGCACAGTGCAGGACATTCAGCCCTAGGCTCTACAACTTCAACGCGAGTGGCAGCCCAGATCCAACCATAAGTCCTTCATACTTGACCACTCTCCAACAACTTTGCCCACAGAATGGA
AGCGGCTCCGTCCTCGCCAACCTCGACCCGACGACCGTGAACACATTCGACAACAACTACTACGCCAACCTCCAGAACAACCAAGGGCTTCTTCAGTCCGATCAAGAGCTGTTCTCAACA
TCTGGCGCCGCAACGATCTCCATCGTCAACAGCTTCAGCGGCAACCAGAGCGCCTTCTTCCAGAGCTTTGCTCAATCGATGATAAACATGGGAAACATTAGTCCTCTCACCGGAAGTAGT
GGGGAGATCAGATCGAATTGCAAGAAGGTCAACGGGAGTTGA

Retrieve as FASTA