Entry information : EgrPrx65
Entry ID 10489
Creation 2012-02-09 (Qiang Li)
Last sequence changes 2016-01-13 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-13 (Achraf Jemmat)
Peroxidase information: EgrPrx65
Name EgrPrx65
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx65
start..stop
S start..stop
EgrPrx66 615 0 1..323 1..323
EglPrx66 615 0 1..323 1..323
EguPrx66 615 0 1..323 1..323
EcamPrx66-1 614 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 64018854..64019072 219 N° 2 64019565..64019756 192 N° 3 64019849..64020017 169 N° 4 64020097..64020488 392
join(64018854..64019072,64019565..64019756,64019849..64020017,64020097..64020488 )


exon

Literature and cross-references EgrPrx65
DNA ref. GenBank:   NW_010092439.1 (64018854..64020577) Phytozome 12:   scaffold_2 (64021241..64022164)
Cluster/Prediction ref. Genebank:   104434128
Protein sequence: EgrPrx65
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   34500.54 (31782.1) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.93 (9.80) Peptide Signal:   %s   cut: 27 range:27-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPSRHPIWVIVAIAFVTALGWGSASAQLSTNFYSKSCPNVLSTVKSVVRSAVSKERRMGASLLRLFFHDCFVNGCDGSILLDDTSSFQGEKTAGPNNKSLRGYNVIDRIKSKVESACPGVVSCADIVAIAARDSVVLLGGPSWEVKLGRRDARTASFSLANSGALPPPTSTLSNLTSLFQAQGLSTRDMVALSGSHTIGQARCISFRSRIYNDSNIDSSFSKTRQRKCPSTVGSGDQNLAPLDLQSPTAFDNAYFKNLLSNKGLLHSDQELFNGGSTDSLVKTYSNNPKTFNSDFASAMIKMGDIKPLTGSKGEIRKICSKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No prediction from phytozome (Exon 1 is missing). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTAGTCGTCATCCGATTTGGGTAATTGTCGCCATAGCTTTTGTAACCGCACTCGGGTGGGGAAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGTCCCAATGTT
TTGAGCACGGTGAAATCTGTTGTCCGGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTCCTTCGCCTCTTCTTTCATGATTGCTTCGTCAAT
GTAATCTTTCCTTCTTCCCTT
CCTTTTTCCCAAATTTCTTCCTGTTCCTTACATATACTCCCCTGCCGCAACCATTTTTACCCTTAAAACCCGAGCCTTATGTCGTAAACAGGGCGAAAGAGTACGCATAATAATTCCATT
ATATAGGCTGTCTATGACCATTTCTATGAATACACTGGCTTCCTTTCTTTTTGAATATATAGACAAAAAAAAAAGTCAATTTGAATTTCAATACTATCTTCCATCGAAAAATATCATGAC
AACATTCATGTGGACTAGTCTCTACATGAAGAATTTTTTTTTTAGAAAATTAATAGGAAAGCATCACCGACCCTTCAATATTTATTATTTGTGAACTTCTCACACTAAGTGGATCGTCGA
TGAGTCAGTCCTGTTCAAAGACATGAGTGGCTTCCTTTTTTTTTTTTTTTTTTTTGGTCATAAAAGACATGCATGGCTTGACATGGTTAGTTTTGTACCAACCAAAAATAGGGGTGCGAT
GGCTCGATACTCCTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATTGACCGGATCAAGTCCAAGGTGGAGTCCGCC
TGTCCAGGTGTGGTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTCCTA
GTATGTGTTGCAATCGATATAGCTAGTTGCGCCTTTAGTCTGAGCTCCTAATTTACT
CTTATTATCAATTGATGGTGATGGGATATTTGAAGCTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCGAGGACCGCGAGCTTCTCACTCGCCAACAGCGGAGCCCTTC
CCCCTCCAACTTCAACGCTCTCCAACCTCACGTCTCTTTTCCAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GTACGTGTTTAATATTGCAGTCTCTGGCCTCGCTCA
GTTGCTAGGTTGCTCATGGGTCATGCATGGGCGTGCATTGCAGGGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGAAGTCGCATATACAACGACAGCAACATCGACAGCTCC
TTTAGCAAGACTAGGCAGCGCAAGTGCCCCAGCACCGTTGGGTCTGGGGACCAAAACCTGGCTCCTCTCGACCTCCAATCTCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTC
AGCAACAAGGGCCTTCTTCACTCGGACCAGGAGCTCTTCAATGGCGGATCCACCGACTCTCTCGTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCCGATTTTGCTTCCGCCATG
ATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGCAAGATCTGTAGCAAGGTCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTAGTCGTCATCCGATTTGGGTAATTGTCGCCATAGCTTTTGTAACCGCACTCGGGTGGGGAAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGTCCCAATGTT
TTGAGCACGGTGAAATCTGTTGTCCGGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTCCTTCGCCTCTTCTTTCATGATTGCTTCGTCAAT
GGGTGCGATGGCTCGATACTC
CTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATTGACCGGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTG
GTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTCCTA
CTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCGAGGACCGCGAGCTTCTCACTCGCC
AACAGCGGAGCCCTTCCCCCTCCAACTTCAACGCTCTCCAACCTCACGTCTCTTTTCCAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GGTCTCACACCATAGGTCAG
GCAAGGTGCATAAGCTTCAGAAGTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGCGCAAGTGCCCCAGCACCGTTGGGTCTGGGGACCAAAACCTGGCT
CCTCTCGACCTCCAATCTCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGGACCAGGAGCTCTTCAATGGCGGATCCACCGACTCTCTC
GTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCCGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGCAAGATCTGTAGC
AAGGTCAATTAG

Retrieve as FASTA