Entry information : EgrPrx64
Entry ID 10490
Creation 2012-02-09 (Qiang Li)
Last sequence changes 2016-01-13 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-13 (Achraf Jemmat)
Peroxidase information: EgrPrx64
Name EgrPrx64
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx64
start..stop
S start..stop
EgrPrx65 600 0 1..321 1..323
EgrPrx66 587 0 1..321 1..323
EglPrx66 587 0 1..321 1..323
EcamPrx66-1 586 0 1..321 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 63972251..63972469 219 N° 2 63972915..63973106 192 N° 3 63973201..63973369 169 N° 4 63973449..63973834 386
join(63972251..63972469,63972915..63973106,63973201..63973369,63973449..63973834 )


exon

Literature and cross-references EgrPrx64
DNA ref. GenBank:   NW_010092439.1 (63972251..63973834) Phytozome 12:   scaffold_2 (63974877..63975510)
Cluster/Prediction ref. Genebank:   104434130
Protein sequence: EgrPrx64
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (295)
PWM (Da):   %s   34391.42 (31660.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.81 (9.81) Peptide Signal:   %s   cut: 27 range:27-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASHHPIWITVVIVFVTALGWGSASAQLSTNFYSKSCPNGLSTVKSVVQSAVSKERRMGASLLRLFFHDCFVNGCDGSILLDDTSSFQGEKTARPNNKSLRGYNVIDRIKSKVESACPGVVSCADIVAIAARDSVVLLGGPSWEVKLGRRDARTASFSLANSGALPPPTSTLSNLISLFQAQGLSTRDMVALSGSHTIGQARCTSFRPHIYNDSNIDSAFRKTRQGQCPFGSGDNNPAPLDLRSPTAFDNAYFKNLLSNKGLLRSDQELFNGGSTDSLVKTYSNNPKTFNSDFASAMIKMGDIKPLKGSQGEIRKICSKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns). No prediction from phytozome. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTCATCATCCGATTTGGATAACTGTCGTGATAGTTTTTGTAACCGCACTCGGGTGGGGAAGTGCCTCCGCGCAACTCTCTACAAACTTCTACTCCAAAAGTTGTCCCAATGGT
TTGAGCACGGTGAAATCTGTTGTCCAGTCCGCGGTGTCGAAGGAGCGCCGCATGGGTGCATCTCTCCTTCGCCTCTTCTTTCATGATTGCTTCGTCAAC
GTAATCTTTCCTTCCTCCCTC
CCTCCCTTTTTCCCAAATTTCTACCTGTTCTCTATATATGCACCCCTGCCTGCCACGACCTTTTTTTACCCTAAAAACCAGAGCCTTATGTCGTAAACGATGCGAAACAATTTGCCTAGA
CACTGGCTTTCTTTCTTTTTTCTTTTTTTTTGAATAAATAGATAAATAAAAGTCGGTTTGAATTTTAATACTATCTACCATCGAAAAATAACATGATAACATTCATGCAGACTAATCTCT
GTATGCAGAATTTTTTTAAATTAATTTGAAAGTTAATAGGAAAGCATCATCGACCCTTCAATATTTAATATTTGTGAACTTCTCCAAGACGAATCACTTCCTTTTTAGTGGATCGTCGAT
GAGTCAGTCCTGTTCAAAGACATGCATGGCTTGACATGGTTAGTTTTGCACCGACCGAAAATAGGGGTGCGATGGCTCGATACTCCTGGACGACACATCCTCGTTCCAAGGGGAGAAGAC
GGCTCGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATCGACCGGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTGGTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCG
CGACTCGGTTGTCCTA
GTATGTGTTGCAATCGATATATAGCTAGTTGCGCCTTTAGTCTGAGCTCCTAATTTACTCTTATTATCAATTGATGGTGATGGGATATTTGAAGCTGGGCGGGC
CAAGTTGGGAAGTGAAACTGGGAAGAAGAGATGCGAGGACCGCGAGCTTCTCACTCGCCAACAGCGGAGCCCTTCCCCCTCCAACTTCAACGCTCTCCAACCTCATCTCTCTTTTCCAAG
CTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GTACGTGTTTAATATTGCAGTCTCTGGCCTCGCTCCATTGCTAGGTCGCTCATGGGTCATGCATGGGCGTGCGTTGCAGGG
TCTCACACCATAGGGCAGGCAAGGTGCACAAGCTTCAGACCTCACATATACAACGACAGCAACATCGACAGCGCCTTTCGCAAGACTAGGCAGGGCCAGTGCCCCTTTGGGTCTGGGGAC
AACAACCCGGCTCCTCTCGACCTCCGATCGCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCGCTCGGACCAGGAGCTCTTCAATGGTGGATCC
ACTGACTCTCTCGTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCAAGGGTTCCCAAGGCGAAATTCGG
AAGATCTGTAGCAAGGTCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTCATCATCCGATTTGGATAACTGTCGTGATAGTTTTTGTAACCGCACTCGGGTGGGGAAGTGCCTCCGCGCAACTCTCTACAAACTTCTACTCCAAAAGTTGTCCCAATGGT
TTGAGCACGGTGAAATCTGTTGTCCAGTCCGCGGTGTCGAAGGAGCGCCGCATGGGTGCATCTCTCCTTCGCCTCTTCTTTCATGATTGCTTCGTCAAC
GGGTGCGATGGCTCGATACTC
CTGGACGACACATCCTCGTTCCAAGGGGAGAAGACGGCTCGCCCAAATAATAAGTCTTTGAGAGGATACAACGTCATCGACCGGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTG
GTCTCTTGCGCAGACATCGTGGCCATTGCTGCTCGCGACTCGGTTGTCCTA
CTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGATGCGAGGACCGCGAGCTTCTCACTCGCC
AACAGCGGAGCCCTTCCCCCTCCAACTTCAACGCTCTCCAACCTCATCTCTCTTTTCCAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GGTCTCACACCATAGGGCAG
GCAAGGTGCACAAGCTTCAGACCTCACATATACAACGACAGCAACATCGACAGCGCCTTTCGCAAGACTAGGCAGGGCCAGTGCCCCTTTGGGTCTGGGGACAACAACCCGGCTCCTCTC
GACCTCCGATCGCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCGCTCGGACCAGGAGCTCTTCAATGGTGGATCCACTGACTCTCTCGTCAAG
ACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCAAGGGTTCCCAAGGCGAAATTCGGAAGATCTGTAGCAAGGTC
AATTAG

Retrieve as FASTA