Entry information : EgrPrx145
Entry ID 10507
Creation 2012-02-13 (Qiang Li)
Last sequence changes 2012-05-15 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-12 (Christophe Dunand)
Peroxidase information: EgrPrx145
Name EgrPrx145
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx145
start..stop
S start..stop
EglPrx145 668 0 1..331 1..331
EguPrx145 603 0 1..331 1..331
PtPrx68 545 0 12..331 3..322
PbPrx68 543 0 12..331 3..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1615886..1616131 246 N° 2 1614938..1615129 192 N° 3 1614642..1614807 166 N° 4 1614107..1614498 392
complement(join(1614107..1614498,1614642..1614807,1614938..1615129,1615886..1616 131))


exon

Literature and cross-references EgrPrx145
DNA ref. Phytozome 12:   scaffold_10 (1616110..1614107)
EST ref. GenBank:   HS047522 [3' end]
Cluster/Prediction ref. Genebank:   104421005
Protein sequence: EgrPrx145
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (296)
PWM (Da):   %s   35229.59 (31830.9)  
PI (pH):   %s   8.85 (9.32) Peptide Signal:   %s   cut: 36 range:36-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSSPPSSSSSSSCSVAVLSLSCILLLLLGSTDAQLSTNFYSKTCPNVFTTVKSQVQAAINKEARMGASLLRLFFHDCFVNGCDGSILLDDTSTFTGEKNAAPNKNSARGFDVVDNIKSAVEKVCPGVVSCADLLAITARDSTVILGGPSWNVKVGRRDARTASQAAANNSIPPPTSNLNNLISFFQNVGLSTRDMVALSGSHTIGQARCTNFRTRIYNETNLDSSLAKTRQSNCPRTVGSGDNNLAPLDLQTPTKFDNNYYKNLLQNKGLLHSDQQLFNGGSTDSLVRTYGSNPSTFTSDFVAGMIKMGDIKPLTGSSGEIRKNCRKIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTTTCTTCGCCCCCATCATCATCATCATCATCATCATGTTCCGTGGCCGTTTTGTCTTTGTCCTGCATCTTGCTTCTCCTCCTGGGGAGCACCGATGCCCAACTTTCCACTAAT
TTTTACTCAAAGACGTGCCCCAACGTCTTCACCACGGTCAAATCCCAGGTGCAAGCGGCCATCAACAAGGAGGCCCGGATGGGTGCCTCTCTCCTCCGCCTATTCTTCCACGATTGCTTT
GTTAAT
GTAAACCGAACATAACCATTCTTCTTAGTTGTTTTTCATCTAATCAATTACGTTGAGTTTCCATTCTTTCCCATTTTCAAAATGCATCCAAGTAATTGTGGGGGATGTACATGT
CGCCTAAGTGTTTCACATGTCCATTCATTCGCCCCGGTCCTTAGAGTTTAGTTCTTGGGTGTTAAGCGTGATCACTAATGTACAACCTTTTAGATAAAGTTCTTATGAGCCATGTTACAT
AAACAAACCATGTTAAGTAACCACAAGCATGAGCACTAAATCTTGGACTCGTTTGCCAAGTATGCTCGTGTATATATTCATGTCCTAGTCGGGTAAGATGTATTTGCTTCAATCTTTTGT
TTTTGTGGTTCAAATGAATTCACATGCACGTCTCTTTCGGGAGGTTCGTGCATGGCGCTGAAAACGAACACGTTTGTTTGGAAATCATGCATTTTTACTGACAAGCCTAGTTAAAATCGT
TTCCACATTTGTGTCCCCAGCTACATGCCTAAAACATAAATCCAGTCCACGCGGTTCCTTCCTATATCGAGAAAGACCGGAAAATTAGTCTGCTCATGGAGCTGTAGTGTTGTTCAACTA
AGGTGTGAACTGTGAAATAAGCCTACCAGCAAAGATCACCATTTAATTAAACAACAAACCAAATAGGCTACCTTTTAGATTAATTGACTAATCTTTCTTTACGTTATCTTCACGTGTATC
CTTGGAAATTCATTTATCCCCCTCTTGCGGCTATTCCCACAGGGCTGCGACGGATCAATTCTTCTAGATGACACGTCCACATTCACCGGAGAAAAGAACGCAGCTCCAAACAAAAACTCC
GCCAGAGGATTCGATGTCGTAGACAACATCAAGTCCGCTGTGGAGAAGGTGTGCCCCGGCGTCGTTTCCTGCGCCGACTTGTTGGCCATCACTGCCCGAGACTCCACCGTCATC
GTAAGC
CCTTCTATCCCTCCATAATTTTTCTTTTTTCTCAAAAAAACTATTAAATACAGGTCCCAATCGCGAATTGGCCATAGCTAATGTCTATTATAGAATATAACTAAGATCGTGTCAAAATTT
GCAGCTTGGAGGGCCAAGCTGGAATGTGAAAGTCGGGAGGAGAGATGCAAGGACCGCAAGCCAAGCTGCTGCTAACAACAGCATTCCTCCCCCGACCTCAAACCTCAACAACCTCATCTC
TTTCTTCCAAAATGTGGGCCTCTCCACTAGAGACATGGTGGCTTTATCTG
GTATGTACACTCATAAACACAATCCTAGATTGGCGCAATTCATCCCTAGGAAAATCATATTAAAAAACAT
ATTCTTTACTTTGATTGTAAGTCGGGAAAAAAAAAAAAAAAAAGATACTAAATCACCAAATCCGTAAAAACAGGTTCACATACAATAGGACAAGCAAGGTGCACAAACTTCAGAACCAGG
ATTTACAATGAAACCAACCTGGACTCTTCCTTGGCCAAGACAAGGCAGAGCAACTGCCCGAGGACAGTTGGCTCAGGGGACAACAATCTAGCCCCTCTCGACTTGCAGACTCCCACCAAG
TTTGACAACAATTACTACAAGAACCTCCTCCAGAACAAGGGCTTGCTCCACTCCGACCAGCAGCTCTTCAATGGCGGTTCTACCGACTCGCTCGTGAGGACTTACGGCAGCAACCCAAGC
ACCTTCACCTCTGACTTCGTGGCGGGCATGATCAAGATGGGGGATATCAAGCCCCTCACTGGATCAAGTGGTGAAATCAGGAAGAATTGCAGGAAGATCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTTTCTTCGCCCCCATCATCATCATCATCATCATCATGTTCCGTGGCCGTTTTGTCTTTGTCCTGCATCTTGCTTCTCCTCCTGGGGAGCACCGATGCCCAACTTTCCACTAAT
TTTTACTCAAAGACGTGCCCCAACGTCTTCACCACGGTCAAATCCCAGGTGCAAGCGGCCATCAACAAGGAGGCCCGGATGGGTGCCTCTCTCCTCCGCCTATTCTTCCACGATTGCTTT
GTTAAT
GGCTGCGACGGATCAATTCTTCTAGATGACACGTCCACATTCACCGGAGAAAAGAACGCAGCTCCAAACAAAAACTCCGCCAGAGGATTCGATGTCGTAGACAACATCAAGTCC
GCTGTGGAGAAGGTGTGCCCCGGCGTCGTTTCCTGCGCCGACTTGTTGGCCATCACTGCCCGAGACTCCACCGTCATC
CTTGGAGGGCCAAGCTGGAATGTGAAAGTCGGGAGGAGAGAT
GCAAGGACCGCAAGCCAAGCTGCTGCTAACAACAGCATTCCTCCCCCGACCTCAAACCTCAACAACCTCATCTCTTTCTTCCAAAATGTGGGCCTCTCCACTAGAGACATGGTGGCTTTA
TCTG
GTTCACATACAATAGGACAAGCAAGGTGCACAAACTTCAGAACCAGGATTTACAATGAAACCAACCTGGACTCTTCCTTGGCCAAGACAAGGCAGAGCAACTGCCCGAGGACAGTT
GGCTCAGGGGACAACAATCTAGCCCCTCTCGACTTGCAGACTCCCACCAAGTTTGACAACAATTACTACAAGAACCTCCTCCAGAACAAGGGCTTGCTCCACTCCGACCAGCAGCTCTTC
AATGGCGGTTCTACCGACTCGCTCGTGAGGACTTACGGCAGCAACCCAAGCACCTTCACCTCTGACTTCGTGGCGGGCATGATCAAGATGGGGGATATCAAGCCCCTCACTGGATCAAGT
GGTGAAATCAGGAAGAATTGCAGGAAGATCAACTAA

Retrieve as FASTA