Entry information : PoVP06_PC9 (MnP3)
Entry ID 10518
Creation 2012-02-22 (Christophe Dunand)
Last sequence changes 2012-02-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PoVP06_PC9 (MnP3)
Name (synonym) PoVP06_PC9 (MnP3)
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoVP06_PC9
start..stop
S start..stop
PoVP06_PC15 721 0 1..357 1..357
PoVP06_IS-1 688 0 1..344 1..345
PoVP04_PC15 561 0 1..357 1..357
PsaVP01 541 0 1..357 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1767677..1767924 248 N° 2 1767980..1768114 135 N° 3 1768167..1768288 122 N° 4 1768340..1768415 76
N° 5 1768476..1768601 126 N° 6 1768653..1768722 70 N° 7 1768777..1768786 10 N° 8 1768837..1768872 36
N° 9 1768928..1769100 173 N° 10 1769155..1769219 65 N° 11 1769267..1769279 13  
join(1767677..1767924,1767980..1768114,1768167..1768288,1768340..1768415,1768476 ..1768601,1768653..1768722,1768777..1768786,1768837..1768872,1768928..1769100,17 69155..1769219,1769267..1769279)


exon

Literature and cross-references PoVP06_PC9 (MnP3)
DNA ref. JGI genome:   scaffold_3 (1767677..1769279)
Cluster/Prediction ref. JGI gene:   137740
Protein sequence: PoVP06_PC9 (MnP3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   358 (336)
PWM (Da):   %s   37347.5 (35026.3)  
PI (pH):   %s   4.37 (4.28) Peptide Signal:   %s   cut: 22 range:22-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKNFSSLVLLTLASQAVRGAVMKRATCADGRTTANAACCVLFPILDDIQEALFDGAECGEEVHESLRLTFHDAIGFSPTKGGGGADGSIVTFDEIETAFHANGGIDDIVDAQKPFIARHNISAGDFIQFAGAVGVSNCPGAPRLNFLLGRPPATAASPNGLIPEPDTVTDILARMGDAGFSPEEVVALLASHSVAAADHVDETIPGTPFDSTPGEFDSQFFIETQLRGTAFPGVGGNQGEVESPLAGEIRIQSDHLARDSRTACEWQSFVNNQAKLQSAFKAAMDKLATLGQDRSKLIDCSDVIPVPKPLQSKAHLPAGLTMNNIEQCASTPFPALTADPGPVTTVPPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAACTTCTCGTCCCTTGTCCTCCTGACTTTGGCATCTCAAGCCGTCCGAGGCGCTGTCATGAAGCGTGCTACTTGCGCTGACGGACGTACTACTGCGAACGCCGCCTGC
TGCGTCCTATTCCCCATTCTGGATGACATCCAAGAGGCCCTCTTTGATGGTGCCGAGTGTGGTGAAGAGGTTCACGAGTCCCTTCGACTCACTTTCCATGACGCTATTGGTTTCTCGCCA
ACCAAAGG
GTATGTGCAAACTTCGCATCTTCGTGAATGGTGACTGACAACAAACACCCAATAGTGGGGGAGGTGCCGACGGCTCTATCGTAACTTTCGACGAAATCGAAACTGCTTTCCA
CGCCAACGGTGGAATCGACGACATAGTCGATGCGCAGAAGCCATTTATTGCTCGCCACAACATCTCCGCCGGTGACTT
GTAAGTTCCTTTGGGAAAATTCGCAGTGAACCCATCTAACGA
GTTATTGTAGCATTCAATTTGCTGGCGCTGTTGGTGTCAGTAACTGCCCAGGAGCTCCAAGACTCAACTTCTTGCTTGGTCGCCCGCCAGCTACAGCAGCTTCGCCCAATGGTTTGATCC
CTGAACCATTCG
GTACGTTTACTTCTTTGGTACTATCAGTCATGCTCTAATAGTGTACATCAGACACCGTCACCGATATCCTTGCCCGTATGGGTGACGCTGGCTTCAGCCCGGAAGAGG
TCGTTGCCCTTCTGGCCTC
GTAAGTCAAACAGTAACCTATCTACCCATCTTGAAAATTGACGAGCTTCGATAATCGCAGACACTCCGTTGCTGCCGCAGACCACGTCGATGAGACCATTC
CAGGAACACCCTTCGACTCCACTCCAGGAGAATTTGACTCTCAATTCTTCATCGAAACCCAACTCCGTGGCACTGCTTTCCCAGG
GTAAGCGATCCATTACGTCGATCGTAGTCGCCAAT
CTCACTTCTTGAACAGTGTTGGCGGTAACCAAGGAGAGGTCGAATCGCCTCTTGCTGGAGAAATCCGTATCCAATCAGATCACGATGTACGTCTTTTCCACCTAAACTCGCTTTATTGTT
CTGATCAACTGTCTTTCTAGCTTGCCCGTGGTATGTATTCAGCTTGCCGGTATACTACTTAATCTCAAAGGTTTGATTAGATTCTCGCACTGCTTGCGAGTGGCAATCCTTCGTTAGTGA
GTACAAGCAACACCATTTCTAGGCCTGATCGCGATACTGAACATCCTCTAGACAACCAGGCCAAGCTTCAATCCGCTTTCAAGGCTGCTATGGACAAGTTGGCTACACTCGGTCAAGATC
GCTCAAAGCTCATTGACTGCTCTGATGTTATCCCTGTCCCCAAGCCATTGCAGAGCAAGGCCCATCTCCCTGCTGGCCTGACGATGAACAACATCGAGCAAGCG
GTACGTGGAGAGTTCG
ATTCACTGATTTGCTTTCTCACTCAATTGCTTCTTTAGTGTGCTTCTACACCCTTCCCAGCTCTCACTGCCGACCCTGGCCCAGTCACTACTGTCCCCCCTGTGTAAGTCTCAAGTTCTC
CTGTTGACACGTAACTCAACAGTTGTTCAGTCCCCCTTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAACTTCTCGTCCCTTGTCCTCCTGACTTTGGCATCTCAAGCCGTCCGAGGCGCTGTCATGAAGCGTGCTACTTGCGCTGACGGACGTACTACTGCGAACGCCGCCTGC
TGCGTCCTATTCCCCATTCTGGATGACATCCAAGAGGCCCTCTTTGATGGTGCCGAGTGTGGTGAAGAGGTTCACGAGTCCCTTCGACTCACTTTCCATGACGCTATTGGTTTCTCGCCA
ACCAAAGG
TGGGGGAGGTGCCGACGGCTCTATCGTAACTTTCGACGAAATCGAAACTGCTTTCCACGCCAACGGTGGAATCGACGACATAGTCGATGCGCAGAAGCCATTTATTGCTCGC
CACAACATCTCCGCCGGTGACTT
CATTCAATTTGCTGGCGCTGTTGGTGTCAGTAACTGCCCAGGAGCTCCAAGACTCAACTTCTTGCTTGGTCGCCCGCCAGCTACAGCAGCTTCGCCC
AATGGTTTGATCCCTGAACCATTCG
ACACCGTCACCGATATCCTTGCCCGTATGGGTGACGCTGGCTTCAGCCCGGAAGAGGTCGTTGCCCTTCTGGCCTCACACTCCGTTGCTGCCGCA
GACCACGTCGATGAGACCATTCCAGGAACACCCTTCGACTCCACTCCAGGAGAATTTGACTCTCAATTCTTCATCGAAACCCAACTCCGTGGCACTGCTTTCCCAGG
TGTTGGCGGTAAC
CAAGGAGAGGTCGAATCGCCTCTTGCTGGAGAAATCCGTATCCAATCAGATCACGAT
CTTGCCCGTGATTCTCGCACTGCTTGCGAGTGGCAATCCTTCGTTAACAACCAGGCCAAGCTT
CAATCCGCTTTCAAGGCTGCTATGGACAAGTTGGCTACACTCGGTCAAGATCGCTCAAAGCTCATTGACTGCTCTGATGTTATCCCTGTCCCCAAGCCATTGCAGAGCAAGGCCCATCTC
CCTGCTGGCCTGACGATGAACAACATCGAGCAAGCG
TGTGCTTCTACACCCTTCCCAGCTCTCACTGCCGACCCTGGCCCAGTCACTACTGTCCCCCCTGTTCCCCCTTCGTAA

Retrieve as FASTA