Entry information : PoCIIBA02_C9 (MnP1)
Entry ID 10519
Creation 2012-02-22 (Christophe Dunand)
Last sequence changes 2012-02-22 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-08-22 (Nizar Fawal)
Peroxidase information: PoCIIBA02_C9 (MnP1)
Name (synonym) PoCIIBA02_C9 (MnP1)
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoCIIBA02_C9
start..stop
S start..stop
PoCIIBA02_PC15 729 0 1..360 1..360
PoCIIBA01_PC15 559 0 1..360 1..358
PoCIIBA01_C9 559 0 1..360 1..358
ParcCIIBA04 531 0 20..360 21..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2545790..2545903 114 N° 2 2545672..2545735 64 N° 3 2545597..2545613 17 N° 4 2545523..2545531 9
N° 5 2545414..2545472 59 N° 6 2545306..2545361 56 N° 7 2545175..2545253 79 N° 8 2544881..2545121 241
N° 9 2544768..2544821 54 N° 10 2544566..2544710 145 N° 11 2544340..2544515 176 N° 12 2544215..2544283 69
complement(join(2544215..2544283,2544340..2544515,2544566..2544710,2544768..2544 821,2544881..2545121,2545175..2545253,2545306..2545361,2545414..2545472,2545523. .2545531,2545597..2545613,2545672..2545735,2545790..2545903))


exon

Literature and cross-references PoCIIBA02_C9 (MnP1)
Literature Ruiz-Duenas, F. J., Fernandez-Fueyo, E., Martinez, M. J., and Martinez, A. T. (2011) C. R. Biol. 334, 795-805
DNA ref. JGI genome:   scaffold_3 (2545903..2544215)
Protein sequence: PoCIIBA02_C9 (MnP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (342)
PWM (Da):   %s   37968.03 (36114.0)  
PI (pH):   %s   4.74 (4.67) Peptide Signal:   %s   cut: 19 range:19-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFKALFTFATLAVAALAAPSHTKRATCSGGRTTAHASCCIWFDVLDDIQENLFDGGECGEEVHSLRLTFHDAIGFSPKLFLQGKFGGLGADGSIMAHSEIETAPANLGVDEIIEAQRPFAIKHKVSFGDFIQFAGAVGVSNCAGGARIPFHAGRLNVSLPSPDLLVPEPSDSVDTILARMGDAGFSPNEVVDLLISHTVAAQDNVDPTIGTPFDSTPNSFDAQFFVETLLKGSITPGNGTNRGQSLSPIPGEFRLTSDFLLARDARTACEWQSFITDHASMVSKFEKVMDKMSTLGQIRALLTDCSDVIPVPKVALTKTPTLPAGRSLADIEACRATPFPALTADPGPVTTVPPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCAAGGCTCTATTCACTTTCGCCACTCTCGCTGTAGCGGCCCTCGCTGCTCCTAGCCACACCAAGCGCGCCACATGCTCGGGCGGCAGGACCACTGCTCATGCATCCGTAGGT
GCTTTGCCCATTATGCTATGACTTGGTTGCTAACAGTGTCCGCGTCAGTGCTGCATCTGGTTCGACGTTTTGGACGACATTCAAGAGAACCTCTTTGATGGTGGCGAGTGCGGTAAGTAG
CTTGCGATCACCTTGCGCATGGCCTGTTCTCAAGTTTACATTGACTGCAGGTGAGGAAGTCCACGAGGTAATAACAATAGATCCTATGCATGGTGAACAATACTGATCTGAGACCAACGC
AACGTTCTGCAGTCTCTCCGTGTAAGGATTATTGACTCGCTCCATCCCACATCGCTGACCCACCATATTAGTTGACCTTCCACGACGCTATTGGATTCTCCCCCAAGCTCTTCCTCCAAG
GCAAATTTGG
GTAAGTGACGCAAGGTTCCTGCCTCTTCGAAGAGTCTCTGAACTTCAAACAGTGGTCTCGGCGCTGATGGTTCCATCATGGCCCACTCTGAGATCGAAACCGCCTTCCGT
AAGTGTTCTACTCATCAGAACAAGAATACACAATCTCAATTCCCTCAAAGCCGCCAATCTCGGTGTCGATGAGATTATTGAAGCTCAAAGGCCGTTTGCCATCAAGCACAAAGTATCTTT
CGGTGACTT
GTACGTGCATCTTGTGATCGTGCGGACCTAGTGTTTATACGCATTGTCATCAGCATCCAATTCGCTGGTGCCGTCGGTGTTAGCAACTGCGCTGGTGGTGCTCGCATTCCT
TTCCACGCGGGACGTCTCAACGTCTCTTTGCCCTCGCCAGACCTCCTCGTCCCCGAACCTAGCGACTCTGTTGACACCATCTTGGCCCGCATGGGCGATGCTGGCTTCTCCCCTAACGAA
GTAGTTGATTTGCTCATCTCTCACACCGTCGCTGCTCAGGACAACGTTGACCCCACTATTCCC
GTAAGCAATCATTGCAAATTCTTACCAGTTCCTATTGCATCCTAACAATCGGCGTAC
AGGGAACTCCCTTCGACTCTACTCCCAACAGCTTCGACGCTCAGTTCTTCGTCGAGGTTCGCAAAAATCTACTAGTACCTAGTCCGCAAAAGTACTAATCGGGGGATCTGTAGACTCTCC
TCAAGGGAAGCATCACCCCCGGAAACGGAACTAACCGAGGCCAATCCCTCTCTCCCATCCCGGGCGAGTTCCGCCTTACTTCTGACTTCCTTCTTGCCCGCGATGCCCGCACTGCTTGCG
AATGGCAATCCTTCATCA
GTGAGTCAGAGTTCCCTCCACCTTCGCCTATATATTGACCCACTTGCCAGCCGACCACGCCTCCATGGTCTCGAAATTCGAGAAGGTCATGGACAAGATGTC
CACTCTAGGCCAAATCCGAGCTCTCCTCACTGACTGCTCCGACGTTATTCCTGTGCCCAAGGTCGCCCTCACCAAGACCCCTACCCTCCCAGCTGGGCGCAGCTTGGCTGATATTGAGGC
CGCA
GTAAGTTGTTTTGCCTTGTGGGCGTTTTCTCTCTATCTGACCATCGTGTACAATAGTGCCGCGCCACGCCATTCCCAGCCCTCACTGCTGACCCTGGCCCAGTTACCACCGTTCCT
CCTGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCAAGGCTCTATTCACTTTCGCCACTCTCGCTGTAGCGGCCCTCGCTGCTCCTAGCCACACCAAGCGCGCCACATGCTCGGGCGGCAGGACCACTGCTCATGCATCCTGCTGC
ATCTGGTTCGACGTTTTGGACGACATTCAAGAGAACCTCTTTGATGGTGGCGAGTGCG
GTGAGGAAGTCCACGAGTCTCTCCGTTTGACCTTCCACGACGCTATTGGATTCTCCCCCAAG
CTCTTCCTCCAAGGCAAATTTGG
TGGTCTCGGCGCTGATGGTTCCATCATGGCCCACTCTGAGATCGAAACCGCCTTCCCCGCCAATCTCGGTGTCGATGAGATTATTGAAGCTCAAAGG
CCGTTTGCCATCAAGCACAAAGTATCTTTCGGTGACTT
CATCCAATTCGCTGGTGCCGTCGGTGTTAGCAACTGCGCTGGTGGTGCTCGCATTCCTTTCCACGCGGGACGTCTCAACGTC
TCTTTGCCCTCGCCAGACCTCCTCGTCCCCGAACCTAGCGACTCTGTTGACACCATCTTGGCCCGCATGGGCGATGCTGGCTTCTCCCCTAACGAAGTAGTTGATTTGCTCATCTCTCAC
ACCGTCGCTGCTCAGGACAACGTTGACCCCACTATTCCC
GGAACTCCCTTCGACTCTACTCCCAACAGCTTCGACGCTCAGTTCTTCGTCGAGACTCTCCTCAAGGGAAGCATCACCCCC
GGAAACGGAACTAACCGAGGCCAATCCCTCTCTCCCATCCCGGGCGAGTTCCGCCTTACTTCTGACTTCCTTCTTGCCCGCGATGCCCGCACTGCTTGCGAATGGCAATCCTTCATCA
CC
GACCACGCCTCCATGGTCTCGAAATTCGAGAAGGTCATGGACAAGATGTCCACTCTAGGCCAAATCCGAGCTCTCCTCACTGACTGCTCCGACGTTATTCCTGTGCCCAAGGTCGCCCTC
ACCAAGACCCCTACCCTCCCAGCTGGGCGCAGCTTGGCTGATATTGAGGCCGCA
TGCCGCGCCACGCCATTCCCAGCCCTCACTGCTGACCCTGGCCCAGTTACCACCGTTCCTCCTGTG
TAA

Retrieve as FASTA