Entry information : PoVP04_PC9 (MnP5)
Entry ID 10521
Creation 2012-02-22 (Christophe Dunand)
Last sequence changes 2017-02-21 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-02-21 (Catherine Mathe)
Peroxidase information: PoVP04_PC9 (MnP5)
Name (synonym) PoVP04_PC9 (MnP5)
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoVP04_PC9
start..stop
S start..stop
PoVP04_PC15 710 0 1..357 1..357
PsaVP01 549 0 1..357 1..361
PcriCIIBB05 547 0 1..357 1..358
PoVP05_PC9 546 0 1..357 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1627604..1627664 61 N° 2 1627424..1627551 128 N° 3 1627307..1627365 59 N° 4 1627123..1627257 135
N° 5 1626946..1627067 122 N° 6 1626817..1626892 76 N° 7 1626728..1626764 37 N° 8 1626663..1626670 8
N° 9 1626525..1626605 81 N° 10 1626399..1626468 70 N° 11 1626335..1626344 10 N° 12 1626242..1626277 36
N° 13 1626013..1626185 173 N° 14 1625917..1625956 40 N° 15 1625837..1625861 25 N° 16 1625770..1625782 13
complement(join(1625770..1625782,1625837..1625861,1625917..1625956,1626013..1626 185,1626242..1626277,1626335..1626344,1626399..1626468,1626525..1626605,1626663. .1626670,1626728..1626764,1626817..1626892,1626946..1627067,1627123..1627257,162 7307..1627365,1627424..1627551,1627604..1627664))


exon

Literature and cross-references PoVP04_PC9 (MnP5)
DNA ref. JGI genome:   scaffold_3 (1627664..1625770)
Cluster/Prediction ref. JGI gene:   137765
Protein sequence: PoVP04_PC9 (MnP5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (336)
PWM (Da):   %s   37231.52 (35070.4)  
PI (pH):   %s   4.24 (4.24) Peptide Signal:   %s   cut: 22 range:22-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTFSGLSSLILALGAVQLSNAASIKRATCADGNTVTNAACCVLFPILEDIQTNLFDGGECGEVHESLRLTFHDAIGFSPSRGGGGADGSLITFSEIETPFHANLGIDEIVEAQKPFVAKHNISAGDFIQFAGAVGVSNCPGAPRLQFFLGRPDAVAPAPDLTVPEPDSVDSILARFADAGFSPAEVVALLASHTIAAADNVDPIPGTPFDSTPSVFDSQFFVETQLRGTSFPGTAGNQGEVESPLRGEMRLQSDSLARDPRTACEWQSFVNNQSKLQSAFKAAMLKLSLVAQDKSKLVDCSDVIPVPPTLNAAAHFPAGLTKNDVEQCAATPFPALTTDPGPVTAVPPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (15 introns). Incorrect prediction from JGI on last exon
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACATTCTCTGGACTCTCTTCTCTGATCTTGGCTCTCGGCGCTGTGCAGCTCTCGAATGGTAGGTAACCTCCTCTTTCGAATGCTTCACGGAACTCATTAATATCCTTTAGCTGCCTC
GATTAAGCGTGCTACATGCGCAGATGGCAACACTGTCACTAATGCTGCTTGCTGCGTCTTGTTCCCAATTTTGGAGGACATCCAGACCAACCTCTTCGACGGTGGAGAGTGCGGTGAAGA
G
GTACAGTTTCATTGGCACCTACCCCTCACACCAGGGCGCCATCTCAAATCTTGGGCAGGTTCATGAGTCACTCCGTCTGACTTTCCACGACGCTATTGGGTTCTCTCCCAGCCGAGGGT
ATGCCTTAAAAGCTCTTACGCTATTTGATATTGACTAGGGGCGACAGTGGTGGAGGAGCTGATGGCTCCTTGATCACCTTCAGCGAGATCGAAACTCCATTCCATGCGAACCTTGGTATC
GACGAAATCGTCGAAGCTCAGAAGCCTTTCGTCGCGAAGCATAACATCTCAGCAGGTGACTT
GTATGTCAACCAACGCAGCATAACCAGCACGACTTTATCTTACCTCGACTTCTAGCAT
CCAGTTCGCTGGAGCTGTTGGTGTTAGTAACTGCCCTGGCGCTCCGCGACTACAATTCTTCCTGGGTCGCCCCGACGCCGTAGCTCCAGCGCCAGACCTGACGGTTCCTGAGCCATTTG
G
TGGGTCATAGAACGAGATGGACGATCAACGTATTCACTAGACCACCCTCTAGACTCGGTGGACAGCATCCTTGCGAGGTTTGCTGACGCTGGCTTCTCGCCTGCTGAAGTCGTTGCCTTG
TTGGCTTC
GTGAGCATCGCGAAAATTGGACTTCAAAAACCTCGACTAATTTAATCCGTAGTCACACCATCGCTGCCGCCGACAATGTTGACCCAACGGTATGTCAGCTCAATCACTCCGT
TCCGTCTATATTCTGACGGCCCTGGTCCCTATAGATTCCTGGGTATGTCTATATGCTCCCTAGGAATCGATGAGAAAGTACTTACCTAGTCACTGACAGAACGCCATTCGACTCGACTCC
TTCAGTTTTCGATTCCCAGTTCTTCGTTGAGACCCAGCTCCGCGGGACAAGCTTCCCAGG
GTAATTATAATCTCTCCAATGCGTTGCCCTGGTATTGGTTCTGAACACACTTTTAGTACT
GCCGGAAACCAGGGCGAAGTTGAATCTCCCCTTCGAGGAGAGATGCGGCTTCAGTCTGACTCCGAG
GTATGTGGGTCACTTTCCATCTCACGGCGGGATTAATCACGTTCTGCCTTGTAG

CTTGCCCGAG
GTAAGAATACCAGTGATCGCGACCCAGCTTTCCGCTAAATCCTTGGGGTTTCCACAGATCCCAGAACCGCATGCGAATGGCAGTCGTTTGTCAGTAAGTGTTAAAGACAT
GTTATGTTTGCACAGGAGCAACAATGAACCGCTGTACAGACAATCAATCCAAGTTGCAATCTGCGTTTAAGGCCGCGATGTTGAAACTGTCTTTGGTCGCCCAGGACAAGAGCAAGCTGG
TCGACTGTTCTGACGTGATCCCTGTTCCTCCAACACTGAACGCAGCCGCACATTTCCCAGCTGGACTTACCAAGAATGACGTCGAGCAAGCC
GTGCGTGCAGATTCCTTGTCTGCTACAT
CTGATTTGTTAATTGTTTGCTCTTTCAGTGCGCTGCTACTCCTTTCCCCGCTTTGACTACTGACCCTGGTTCGTATCTATGTTTCCCGGGAGCTATACATGTCTTGCTAACATTCTTCTG
CAGGTCCAGTCACTGCCGTCCCGCCCGTGTGAGTACCTGAATCCAAGCAATTTTGTATGAAACTGATGCATCAGCATTCCAGCCCTCCTTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACATTCTCTGGACTCTCTTCTCTGATCTTGGCTCTCGGCGCTGTGCAGCTCTCGAATGCTGCCTCGATTAAGCGTGCTACATGCGCAGATGGCAACACTGTCACTAATGCTGCTTGC
TGCGTCTTGTTCCCAATTTTGGAGGACATCCAGACCAACCTCTTCGACGGTGGAGAGTGCGGTGAAGAG
GTTCATGAGTCACTCCGTCTGACTTTCCACGACGCTATTGGGTTCTCTCCC
AGCCGAGG
TGGTGGAGGAGCTGATGGCTCCTTGATCACCTTCAGCGAGATCGAAACTCCATTCCATGCGAACCTTGGTATCGACGAAATCGTCGAAGCTCAGAAGCCTTTCGTCGCGAAG
CATAACATCTCAGCAGGTGACTT
CATCCAGTTCGCTGGAGCTGTTGGTGTTAGTAACTGCCCTGGCGCTCCGCGACTACAATTCTTCCTGGGTCGCCCCGACGCCGTAGCTCCAGCGCCA
GACCTGACGGTTCCTGAGCCATTTG
ACTCGGTGGACAGCATCCTTGCGAGGTTTGCTGACGCTGGCTTCTCGCCTGCTGAAGTCGTTGCCTTGTTGGCTTCTCACACCATCGCTGCCGCC
GACAATGTTGACCCAACG
ATTCCTGGAACGCCATTCGACTCGACTCCTTCAGTTTTCGATTCCCAGTTCTTCGTTGAGACCCAGCTCCGCGGGACAAGCTTCCCAGGTACTGCCGGAAAC
CAGGGCGAAGTTGAATCTCCCCTTCGAGGAGAGATGCGGCTTCAGTCTGACTCCGAG
CTTGCCCGAGATCCCAGAACCGCATGCGAATGGCAGTCGTTTGTCAACAATCAATCCAAGTTG
CAATCTGCGTTTAAGGCCGCGATGTTGAAACTGTCTTTGGTCGCCCAGGACAAGAGCAAGCTGGTCGACTGTTCTGACGTGATCCCTGTTCCTCCAACACTGAACGCAGCCGCACATTTC
CCAGCTGGACTTACCAAGAATGACGTCGAGCAAGCC
TGCGCTGCTACTCCTTTCCCCGCTTTGACTACTGACCCTGGTCCAGTCACTGCCGTCCCGCCCGTCCCTCCTTCCTAA

Retrieve as FASTA