Entry information : EcamPrx25
Entry ID 10524
Creation 2012-02-22 (Christophe Dunand)
Last sequence changes 2013-10-11 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-10 (Christophe Dunand)
Peroxidase information: EcamPrx25
Name EcamPrx25
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx25
start..stop
S start..stop
EgrPrx25 616 0 1..322 1..319
EglPrx25 614 0 1..322 1..319
EguPrx25 600 0 1..322 1..319
EcamPrx24 585 0 1..322 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..225 225 N° 2 1676..1867 192 N° 3 1987..2152 166 N° 4 2260..2642 383
join(1..225,1676..1867,1987..2152,2260..2642)


exon

Literature and cross-references EcamPrx25
Protein sequence: EcamPrx25
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (294)
PWM (Da):   %s   34110.68 (31081.1) Transmb domain:   %s   i13-35o
PI (pH):   %s   7.36 (6.65) Peptide Signal:   %s   cut: 29 range:29-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACENSSPRRARHAFLLLLCFLLGTASARLSSTFYFTSCPSALHTIKSGVNSAVSSEARMGASLLRLHFHDCFVNGCDASILLDDTTNFTGEKTAGPNDNSIRGYEVIDTIKSQLESSCPGVVSCADILAVAARDSVVALGGPSWRVLLGRRDSTTASLSAANSDIPAPTLSLSDLITAFSNKGFTAKEMVALSGSHTIGQARCTTFQTRLYNESDINSTFATSLKENCPSSGGDNNLSPLDTTSPTYFDSAYFKNLQTQKGLLHSDQQLFSGGSTDAQVNTYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKNCRKL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCGAGAACTCTTCTCCCAGACGGGCCAGACACGCCTTCTTATTATTGCTGTGTTTCCTACTTGGAACAGCCTCGGCTCGGCTGTCCAGCACTTTCTACTTCACATCCTGTCCC
AGCGCCCTCCACACCATTAAGTCCGGCGTGAACTCCGCAGTGTCCAGCGAGGCCCGCATGGGCGCCTCACTTCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GCAAGTCCCTCTCCT
CCGAGTCTCTCCTCTCTTTCCCATTGATTTCTACCTTTGTTTCTCTTCTGTCATTCAAGCTGCATGCAAGCGTGCGTGCATGATGCATCTTTATGCCTGTGCTTGTGAAACATTCCAACC
ACCCTCATAGTCAAAGGCATCATTAGATTTCGCTTCTACGAAATTAATGTACTCTCTTTTTCGCTAACCAAAACAGTAGGTACGAGATTCGCATATTGAATTAGTCGAGTCTGACCGACC
TTTTTGGTATATTGTTGTGCCATGCATTTTTGTGAGTTTATTAAAGGTGGACAAGAATGTTGTTGTGTATACCCTTAATTTTTTTATTACAGAGACAATATATGCTATAATTTTCTTTAT
TATAAAAGCCATGCAGGCGACGTACTTTATGCTGATCACGCTGTTGATAAGATGTGCATGTATGATTAGCTACCTGTTTTAAACCCGATGAACTCGATGATTTAGATCATGCAAAAGTCC
TAAACGTTGCAGCTGTAAAAAAGAGAGAGACGGCCATGCTTTTTAAGTCAAATACGCGTTTATCACGTTTGGCAAAACCAATCAGTCTTTCTCAATAGGTTTCAATCATATTTTGATCAC
CATCCCTTTGGTTGCCATACTTTTCTAAATTTAAAATGATATTTTATGGTAAAATATCAGTTTTAATGGAATTTGTTAATCCAATGGTATTCTAAAAATCATATTAGATCTTTGAATAAA
TGAATTTCGCCTTGTGCATGGCCTCACTAGTTTGCTTCCAACACAANNNNNNNNNNNNNNNNNNNNTGTGCATAATTTAAGAGTTGCCTGCATCCTAATGGACCTTTCTCCATCAAACAT
GCCGTCTCTACTTTGATCTTGATATTCATAGGCTGATCTATTTTTTAAATAACAAATATGACATGTTTACAACTTTCTCGGTTAGATTTGTGGGTTGCTTTTCTTTTTCCTATATAGGTT
GGAAATCGTCTAGATTTTCATTTTTGATCGATACATAATTGGTCATTCGAGAAGGCCAAACTTAGGCTAATTCTAGTGAATCATAAAGTCAGTGACTCCCCTCTGTTATATATTAAAGAA
CGCGCCATGTTGCAAACCAAAAATCTTGATTTAGAGAACTCTTCACAGCGCAATCATTTTGTTTATAGTCCGACGATTATTGGATGCATTGTTCCTTGAGAAACAACAGGGAGTAAAGTC
AAGAGGCATGAGCAAGAGTGTCACCTTCGTCCAGATTGGTGTCTCTAGTCGTTGATAGTGGGGGGCAAAAAGGGGGAATGATAAGGGAAACAACCGGTGTTTATGCTCTCATTTCAGGAA
AATTTATAACAAGCAAACCTCCTGTCTACAACCAATGAATGAAATGAACGCCAATTGGATCGATTTTCCAACTAGAAGGGCTGATTAATAATGTGTGGTGCAAAATATGAAACAGGGATG
TGATGCGTCGATTCTGTTGGATGACACCACGAACTTCACTGGGGAGAAGACCGCCGGCCCGAATGACAATTCCATACGTGGATACGAGGTGATCGACACGATCAAGTCCCAACTGGAGAG
CAGCTGCCCTGGGGTTGTGTCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTGTTGTTGCC
GTAAGTGCACATTTTCTTCTTAACACTAGCAATCAATTGGGAGGAAAAAATCA
CATGCTATGTTACCTTTCTATATTAGCACTAACATGTTTGGATTTATTTGTTTATTTAATTTTCAGTTAGGTGGCCCAAGTTGGAGAGTCTTATTAGGAAGAAGAGACTCGACCACCGCA
AGCCTAAGTGCTGCTAATAGCGACATTCCTGCCCCAACTTTGAGCCTTAGCGACCTCATCACCGCCTTCTCTAACAAAGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GTCTCTTT
TTTTTTTTTTTTTGGTTGCATTTTATAATAAAGAATTATAATAAAGCTTGACTGATATACTAAGATCGATTTACAAACATGTTCAATTGTTGTCAATAGGATCGCACACGATAGGTCAAG
CCCGATGCACAACTTTCCAGACCCGGCTTTATAATGAGAGCGACATCAACAGCACGTTCGCAACGTCACTAAAAGAAAACTGCCCAAGCTCCGGAGGTGACAACAATCTCTCTCCTCTCG
ACACCACGAGCCCGACGTACTTCGACAGCGCCTACTTCAAGAACTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAGCAATTGTTCAGTGGTGGTTCCACGGATGCTCAAGTGAACA
CTTACAGTAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGGAACCTCAGCCCACTCACCGGCTCAAGCGGTCAGATTAGGAAGAACTGCAGGAAACTCA
AC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCGAGAACTCTTCTCCCAGACGGGCCAGACACGCCTTCTTATTATTGCTGTGTTTCCTACTTGGAACAGCCTCGGCTCGGCTGTCCAGCACTTTCTACTTCACATCCTGTCCC
AGCGCCCTCCACACCATTAAGTCCGGCGTGAACTCCGCAGTGTCCAGCGAGGCCCGCATGGGCGCCTCACTTCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GGATGTGATGCGTCG
ATTCTGTTGGATGACACCACGAACTTCACTGGGGAGAAGACCGCCGGCCCGAATGACAATTCCATACGTGGATACGAGGTGATCGACACGATCAAGTCCCAACTGGAGAGCAGCTGCCCT
GGGGTTGTGTCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTGTTGTTGCC
TTAGGTGGCCCAAGTTGGAGAGTCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGT
GCTGCTAATAGCGACATTCCTGCCCCAACTTTGAGCCTTAGCGACCTCATCACCGCCTTCTCTAACAAAGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GATCGCACACGATAGGT
CAAGCCCGATGCACAACTTTCCAGACCCGGCTTTATAATGAGAGCGACATCAACAGCACGTTCGCAACGTCACTAAAAGAAAACTGCCCAAGCTCCGGAGGTGACAACAATCTCTCTCCT
CTCGACACCACGAGCCCGACGTACTTCGACAGCGCCTACTTCAAGAACTTGCAGACCCAAAAGGGGCTTCTTCACTCGGACCAGCAATTGTTCAGTGGTGGTTCCACGGATGCTCAAGTG
AACACTTACAGTAGCAATTCGGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGGAACCTCAGCCCACTCACCGGCTCAAGCGGTCAGATTAGGAAGAACTGCAGGAAA
CTCAAC

Retrieve as FASTA