Entry information : CzmCIIAC01
Entry ID 10525
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2015-04-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-28 (Christophe Dunand)
Peroxidase information: CzmCIIAC01
Name CzmCIIAC01
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Cercospora
Organism Cercospora zeae-maydis    [TaxId: 135779 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CzmCIIAC01
start..stop
S start..stop
ZcelCIIAC03 392 6e-137 29..299 140..409
MpopCIIAC 360 2e-125 28..298 74..350
SpopCIIAC 359 3e-125 27..298 61..334
MpiCIIAC[P]02 335 5e-116 29..295 53..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..81 81 N° 2 415..1233 819  
join(1..81,415..1233))


exon

Literature and cross-references CzmCIIAC01
DNA ref. GenBank:   KO527668.1 [5' end] JGI genome:   scaffold_4 (1437145..1435913)
EST ref. GenBank:   FG249022.1 [3' end]
Cluster/Prediction ref. JGI gene:   56696
Protein sequence: CzmCIIAC01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   299
PWM (Da):   %s   31605.27  
PI (pH):   %s   6.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGCTGNRGQTCGGSDRLNVYYAGSNNNAVVSDLASNMRTSGLCNNISRAAIRYAFHDSATFSNALPFYPPAAGGADGSLMLSTAEIDRIDSEGLHDFHNFIRAKFSTYKAAGYQLSAADLVQVAGSVGVLACPGGRVGRMLVGRTDTSTAAPDGLLPQAFGPGSDHDTLFQLFADKGFTARDLAALLGAHSTSIANFQQRFGMPANTAQDTTPGEWDVLYYNQTYFPVSGMGRFDSDINLARNESRTAVGFQFRSFVGRPAQWGASFASAWQALTLLGVPQSVRSNMQDCTTVVSGAFP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron) and 1 EST. Incorrect prediction from JGI (PS is missing, first exon).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATGTACCGGTAACAGAGGACAGACTTGTGGTGGCTCTGACCGGTTGAATGTCTACTACGCAGGATCTAATAACAACGTGCGCGCTTGCTCTGCTGCGGGCAGCACAACGAGCAGC
ACCAGTACAAGCACGACCTCGAGGCCCACTTCGACATCCGTCACGACATCTAGCTCCAGAGCGGCTTCTACCAGCTCAAGTATTACAACCACGACACGATCCACTACTACACTCGTTTCG
ACGTCTTCTGCAACTTCTGTCATAACGTCTCGCTCAAGTAGCTCATCTACTTCCTCAGCTGGCCTTTCGACGACCAGCGCAACAGGTACAACTACGACGCGATCAACTACTATATCTTCG
TCAACCACGACTGCGACTACGCCTGCGTCAACGGTCTGTCCTGATTTCTGGCAGGCTGTGGTCTCGGACTTGGCTTCGAACATGCGCACCAGCGGGCTATGTAACAATATCTCGCGAGCG
GCAATTCGATATGCCTTCCACGACTCCGCCACGTTCTCCAACGCACTTCCCTTTTATCCGCCCGCAGCAGGAGGCGCTGACGGCTCATTGATGCTTTCTACAGCAGAAATAGACCGCATC
GACTCCGAAGGCCTTCACGACTTCCACAATTTCATCCGAGCCAAATTCAGCACTTATAAAGCTGCAGGTTATCAACTCAGCGCAGCAGATCTCGTTCAAGTCGCTGGATCCGTAGGTGTT
CTGGCCTGCCCCGGTGGACGTGTAGGTCGTATGTTGGTCGGACGTACAGATACTTCCACAGCCGCTCCGGATGGGCTCCTTCCACAAGCCTTCGGTCCCGGCTCCGATCACGATACGCTC
TTCCAACTCTTCGCCGACAAGGGCTTCACTGCCCGAGACTTGGCGGCTTTGCTCGGTGCCCATAGCACTTCGATCGCCAATTTCCAACAACGATTCGGTATGCCTGCCAATACCGCACAA
GACACGACTCCAGGGGAGTGGGATGTACTCTATTACAACCAGACATATTTCCCAGTCTCAGGCATGGGACGCTTCGATAGTGATATCAACCTCGCGAGAAACGAGAGCCGGACTGCTGTG
GGGTTCCAATTTCGAAGTTTTGTCGGGAGACCTGCGCAGTGGGGGGCTTCGTTTGCGAGTGCATGGCAGGCATTGACTTTGTTGGGGGTGCCGCAGAGTGTGAGGAGTAATATGCAGGAT
TGCACAACTGTTGTTTCTGGGGCATTTCCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATGTACCGGTAACAGAGGACAGACTTGTGGTGGCTCTGACCGGTTGAATGTCTACTACGCAGGATCTAATAACAACGCTGTGGTCTCGGACTTGGCTTCGAACATGCGCACCAGC
GGGCTATGTAACAATATCTCGCGAGCGGCAATTCGATATGCCTTCCACGACTCCGCCACGTTCTCCAACGCACTTCCCTTTTATCCGCCCGCAGCAGGAGGCGCTGACGGCTCATTGATG
CTTTCTACAGCAGAAATAGACCGCATCGACTCCGAAGGCCTTCACGACTTCCACAATTTCATCCGAGCCAAATTCAGCACTTATAAAGCTGCAGGTTATCAACTCAGCGCAGCAGATCTC
GTTCAAGTCGCTGGATCCGTAGGTGTTCTGGCCTGCCCCGGTGGACGTGTAGGTCGTATGTTGGTCGGACGTACAGATACTTCCACAGCCGCTCCGGATGGGCTCCTTCCACAAGCCTTC
GGTCCCGGCTCCGATCACGATACGCTCTTCCAACTCTTCGCCGACAAGGGCTTCACTGCCCGAGACTTGGCGGCTTTGCTCGGTGCCCATAGCACTTCGATCGCCAATTTCCAACAACGA
TTCGGTATGCCTGCCAATACCGCACAAGACACGACTCCAGGGGAGTGGGATGTACTCTATTACAACCAGACATATTTCCCAGTCTCAGGCATGGGACGCTTCGATAGTGATATCAACCTC
GCGAGAAACGAGAGCCGGACTGCTGTGGGGTTCCAATTTCGAAGTTTTGTCGGGAGACCTGCGCAGTGGGGGGCTTCGTTTGCGAGTGCATGGCAGGCATTGACTTTGTTGGGGGTGCCG
CAGAGTGTGAGGAGTAATATGCAGGATTGCACAACTGTTGTTTCTGGGGCATTTCCTTGA

Retrieve as FASTA