Entry information : HcyCIIBC03
Entry ID 10531
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2016-02-01 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-01 (Achraf Jemmat)
Peroxidase information: HcyCIIBC03
Name HcyCIIBC03
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Hebeloma
Organism Hebeloma cylindrosporum    [TaxId: 76867 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HcyCIIBC03
start..stop
S start..stop
GmarCIIBC06 548 0 1..349 1..354
GmarCIIBC 518 0 1..349 1..354
GmarCIIBC14 506 0 1..349 1..354
GmarCIIBC12 506 0 1..349 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..127 127 N° 2 177..241 65 N° 3 293..351 59 N° 4 467..522 56
N° 5 576..588 13 N° 6 641..706 66 N° 7 764..885 122 N° 8 936..1030 95
N° 9 1081..1095 15 N° 10 1154..1179 26 N° 11 1230..1244 15 N° 12 1298..1354 57
N° 13 1408..1487 80 N° 14 1548..1583 36 N° 15 1639..1727 89 N° 16 1789..1866 78
N° 17 1926..1994 69  
join(1..127,177..241,293..351,467..522,576..588,641..706,764..885,936..1030,1081 ..1095,1154..1179,1230..1244,1298..1354,1408..1487,1548..1583,1639..1727,1789..1 866,1926..1994)


exon

Literature and cross-references HcyCIIBC03
DNA ref. JGI genome:   scaffold_26 (417868..415875)
Cluster/Prediction ref. JGI gene:   82176
Protein sequence: HcyCIIBC03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (327)
PWM (Da):   %s   36564.54 (34215.2)  
PI (pH):   %s   6.39 (5.88) Peptide Signal:   %s   cut: 23 range:23-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFARLSAVIAFAFATVQVAKGSLIKRITCPSGQVTANKACCALFPIVDRIQKDLFDGGECGEAHSALRLAFHDAIGFSINGTGGGADGSILAFNKTENAHANAGIDDITDRQFPVFLETGLSAGDFVHLAAAVGTGNCPGAPRLRFFFGRPPPKAAAPDLTVPEPDSVTAILSRFADAGFAPHEAVALLSSHTIAADEVDPTIPGTPFDSTVGTFISDSQVFLEVLLKGKLFPGNGSQPGEVLSPLAGEMRLQSDFVISDSRTACLWQNMINNQTRMTRQFKRAMHKMQLLGQGTLTDCSVIPVPKPFAGPIKYPASFSQADVQQACVQSAFPSLATVAGPAPTVAPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns). Incorrect prediction from JGI: two short exons are missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTGCTCGTCTCTCAGCTGTCATCGCGTTTGCGTTTGCCACTGTTCAGGTTGCGAAAGGTAGTCTGATCAAACGTATTACATGTCCTTCTGGACAGGTAACCGCGAACAAAGCT
TGCTGCG
GTCAGATATCGCCCATATTCCTTGACCGTATTCTTATGTCTGGCTGCAGCCCTTTTCCCGATCGTCGATCGGATCCAAAAAGATCTTTTTGATGGTGGCGAGTGCGGAGAAGA
G
GTCAGCAAAATGAATCTGCAGCGCCTGTAGTCCATTCTCAAACCTCAACAGGCTCACTCCGCTCTTCGCCTAGCTTTCCACGATGCCATCGGATTCTCCATTAATGGCACGCCCTTTCA
TAGCGATACCGTTTCTCTTGACTGATCTATTGCTATTTTTTAGGTGGAAAGTTAGTAACCTGGCTTAATGCTCATCGTTGTTGCTATACTCACTGCCATCACCAAGGGGAGGAGGGGCTG
ATGGTTCCATTCTGGCCTTCAACAAGACCGAAAATGCTTTCC
GTAAGTAGGATACTTCTCCCAAGGTTACTATAAATTTTGATCGATCTTTATAGATGCTAATGCAGGGTATATCAATTT
TCTTTGGAAGACGCTGGTCGCTCACTCTGAAAATATCAAGAATTGACGACATTACCGATCGACAATTCCCTGTCTTCCTCGAGACCGGTTTAAGTGCCGGCGACTTGTCAGCATTCTTTT
TCTCTTAGATCTCCCTCATAGTGATGGAATATACTGTGCTTAGCGTGCATTTGGCGGCTGCAGTCGGGACAGGCAACTGCCCTGGTGCGCCCAGATTGAGATTTTTCTTCGGTCGCCCAC
CACCGAAGGCCGCTGCTCCCGATCTTACTGTGCCGGAGCCCACTG
GTGAGTATTCAATGTCGAAATTGATCCAGCATCGTAATGGCTCCCAATAGATAGCGTCACCGCTATCCTCTCCCG
TTTCGCCGATGCCGGATTTGCCCCTCATGAAGCAGTTGCCCTCCTTTCTTCCCATACAATTGCGGCTGCC
GTAAGTATATTATTATGATTAGGAAACTCTCTAAAGTTTCCGTTATCTAG

GATGAAGTTGATCCG
GTAATTCTTTCCCCGTTTCCGTCATTCTCATGTAACAAACATAGCTCTGCCTTTCTAGACGATCCCAGGGACCCCGTTCGATAGGTGTGGAGGCTATATTTCTTA
TTGAACCCATTATAATGACCCATTTACAGCACTGTCGGGACATTGTGAGCATGCCGTTGTATCAGTGCCGGTGACATGATTTGTTAACCTCCTGCAACATCAGTGATAGTCAAGTCTTCC
TCGAAGTTCTCTTGAAGGGCAAACTCTTCCCTGG
GTAACTTACTTGGTCTTCGCATGCAATCATCGATTTAACGTGGCTACTTCTAGGAATGGCAGCCAGCCCGGTGAAGTCTTGTCTCC
GTTGGCCGGGGAAATGAGGCTTCAAAGCGATTTTGTCATCTCGCAAG
GTCTGTCCTTCAACCAGGTGCACTTGGTTTTTGGTCTCATAGTGTATTACCGGAACCTAGACTCGAGGACGGC
TTGTTTGTGGCAGAATATGATCA
GTGGGTTACTCTCCCAAAATTATTATTTTTGATTACTCACTAAGAAGATCGTTAGACAACCAGACTAGAATGACGAGGCAGTTTAAGCGTGCGATGC
ATAAAATGCAACTCCTTGGACAAGGGACCCTCACGGATTGTTCTGAT
GTTCGTTCTCGAGCAACATCATATTTAAATGCTCATAGCGCTCAATACTGATTAAATTCAGGTTATCCCTGTC
CCCAAGCCCTTCGCTGGGCCCATCAAGTACCCCGCAAGCTTCTCCCAGGCAGATGTGCAACAAGCT
GTGGGTCACTCTTCCTTTCCTTCTGCCAATTTGTAAAACCTAAATATTGGAGAT
GATAGTGCGTACAATCTGCCTTCCCAAGTCTTGCCACTGTTGCCGGTCCAGCGCCTACCGTTGCTCCAGTGTGA

Retrieve as FASTA