Entry information : BdotCIIAC01
Entry ID 10533
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-10-15 (Catherine Mathe (Scipio))
Peroxidase information: BdotCIIAC01
Name BdotCIIAC01
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Botryosphaeria
Organism Botryosphaeria dothidea    [TaxId: 55169 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdotCIIAC01
start..stop
S start..stop
ApulCIIAC02 306 1e-102 108..397 53..346
ApruCIIAC01 301 2e-100 108..397 74..362
BdotCIIAC02 299 8e-100 70..397 1..340
ApulCIIAC01 278 3e-92 108..397 18..307
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33332..33485 154 N° 2 33614..34665 1052  
join(33332..33485,33614..34665)


exon

Literature and cross-references BdotCIIAC01
DNA ref. JGI genome:   NODE_11245_length_106197_cov_64.607468 (33332..34665)
Cluster/Prediction ref. JGI gene:   823
Protein sequence: BdotCIIAC01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   401
PWM (Da):   %s   42933.66  
PI (pH):   %s   8.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLPLSWHPNGEARKPVRTRVAQHYQQAPSTDGSGRHETTVASNIAAMAAIFVKLFVISFCWEIPISRLKMRFSATLMTACTVSSVHALSFPSLDLPSITLPSLFRRQSSSCPAVWTQISSELSTAFIANGQCNDLARAALRFAFHDQGTFTNTAAFTAPASGGADGSLLLNDEEMTRIENNNDPIRSVRSFLLDLMAKHSVGAADLVAFAANAAIKSCPGGPTVRTVVGRNDSSAAAAPRLLPPGFGPGSDHDSILQLFRDEGFSPSELAALMGAHSVVRAFDQAQLPRGVELDSTPGQFDVKYYDEMLSAQPPQGVGRLDSDRNLAKDGTTVGNQFKRFVGDQSRFEERFADAMFKLSVLGVPQNEVARFVDCTAVLPVGSAKRDVRARAINARARGGSD

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCCGCTCAGCTGGCATCCCAATGGGGAAGCTCGCAAACCGGTACGAACCCGAGTGGCTCAGCACTACCAACAAGCTCCGAGCACTGACGGAAGCGGACGGCACGAGACTACGGTA
GCGTCGAACATTGCTGCAATGGCCGCTATCTTTG
GTGTGTACTGCAGTGCAGCTCTTGAGAGTGTGCCTCTATAAAACCACACCTCCCACGCACGACGTCAGGTTCACCCATCACTCATC
AGTTGCTCCACTATCCTGAGCGGTGAAGCTTAATACCTCCAGTCAAGCTTTTCGTAATCTCGTTCTGCTGGGAAATCCCCATCTCTCGTCTCAAAATGCGCTTCTCCGCCACTCTCATGA
CGGCCTGCACCGTCTCCTCTGTGCACGCCCTCTCCTTCCCCTCTCTCGACCTCCCATCCATCACTCTCCCCTCCCTCTTCCGCCGCCAATCTTCTTCCTGCCCGGCGGTCTGGACGCAAA
TCTCCTCCGAGCTCTCCACCGCCTTCATCGCCAACGGCCAGTGCAACGACCTCGCCCGCGCCGCCCTCCGCTTCGCCTTCCACGACCAAGGCACCTTCACCAACACAGCCGCCTTCACCG
CCCCCGCCAGCGGCGGCGCCGACGGCTCGCTCCTCCTCAACGACGAGGAGATGACGCGCATCGAAAACAACAACGACCCGATCCGTAGCGTGCGCTCCTTCCTCCTCGACCTGATGGCCA
AGCACTCCGTCGGCGCCGCCGACCTCGTCGCCTTCGCCGCCAACGCGGCCATCAAGTCCTGCCCGGGCGGCCCCACCGTCCGCACCGTCGTCGGCCGCAATGACTCGTCCGCCGCCGCGG
CCCCGCGGCTCCTCCCCCCCGGCTTCGGCCCGGGCAGCGACCACGACTCCATCCTCCAGCTCTTCCGCGACGAAGGGTTCAGTCCCAGCGAGCTCGCCGCGCTGATGGGCGCGCATAGCG
TCGTGCGCGCGTTCGACCAGGCCCAGCTGCCGCGCGGCGTCGAGCTCGACTCGACGCCCGGCCAGTTCGACGTCAAGTACTACGATGAGATGCTGAGCGCGCAGCCACCGCAGGGCGTGG
GCAGGCTGGATTCGGACCGCAATCTGGCCAAGGACGGGACGACGGTCGGGAACCAGTTCAAGCGGTTCGTCGGCGACCAGTCAAGGTTTGAGGAGCGGTTCGCGGATGCGATGTTTAAGC
TGAGCGTGCTGGGCGTGCCGCAGAATGAGGTTGCCAGGTTTGTGGATTGTACGGCGGTGCTGCCCGTGGGGAGTGCGAAGAGGGATGTTAGGGCGAGGGCGATCAATGCGAGGGCGAGGG
GTGGCAGTGATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCCGCTCAGCTGGCATCCCAATGGGGAAGCTCGCAAACCGGTACGAACCCGAGTGGCTCAGCACTACCAACAAGCTCCGAGCACTGACGGAAGCGGACGGCACGAGACTACGGTA
GCGTCGAACATTGCTGCAATGGCCGCTATCTTTG
TCAAGCTTTTCGTAATCTCGTTCTGCTGGGAAATCCCCATCTCTCGTCTCAAAATGCGCTTCTCCGCCACTCTCATGACGGCCTGC
ACCGTCTCCTCTGTGCACGCCCTCTCCTTCCCCTCTCTCGACCTCCCATCCATCACTCTCCCCTCCCTCTTCCGCCGCCAATCTTCTTCCTGCCCGGCGGTCTGGACGCAAATCTCCTCC
GAGCTCTCCACCGCCTTCATCGCCAACGGCCAGTGCAACGACCTCGCCCGCGCCGCCCTCCGCTTCGCCTTCCACGACCAAGGCACCTTCACCAACACAGCCGCCTTCACCGCCCCCGCC
AGCGGCGGCGCCGACGGCTCGCTCCTCCTCAACGACGAGGAGATGACGCGCATCGAAAACAACAACGACCCGATCCGTAGCGTGCGCTCCTTCCTCCTCGACCTGATGGCCAAGCACTCC
GTCGGCGCCGCCGACCTCGTCGCCTTCGCCGCCAACGCGGCCATCAAGTCCTGCCCGGGCGGCCCCACCGTCCGCACCGTCGTCGGCCGCAATGACTCGTCCGCCGCCGCGGCCCCGCGG
CTCCTCCCCCCCGGCTTCGGCCCGGGCAGCGACCACGACTCCATCCTCCAGCTCTTCCGCGACGAAGGGTTCAGTCCCAGCGAGCTCGCCGCGCTGATGGGCGCGCATAGCGTCGTGCGC
GCGTTCGACCAGGCCCAGCTGCCGCGCGGCGTCGAGCTCGACTCGACGCCCGGCCAGTTCGACGTCAAGTACTACGATGAGATGCTGAGCGCGCAGCCACCGCAGGGCGTGGGCAGGCTG
GATTCGGACCGCAATCTGGCCAAGGACGGGACGACGGTCGGGAACCAGTTCAAGCGGTTCGTCGGCGACCAGTCAAGGTTTGAGGAGCGGTTCGCGGATGCGATGTTTAAGCTGAGCGTG
CTGGGCGTGCCGCAGAATGAGGTTGCCAGGTTTGTGGATTGTACGGCGGTGCTGCCCGTGGGGAGTGCGAAGAGGGATGTTAGGGCGAGGGCGATCAATGCGAGGGCGAGGGGTGGCAGT
GATTGA

Retrieve as FASTA