Entry information : BdotCIIAB03
Entry ID 10535
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-10-15 (Catherine Mathe (Scipio))
Peroxidase information: BdotCIIAB03
Name BdotCIIAB03
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Botryosphaeria
Organism Botryosphaeria dothidea    [TaxId: 55169 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdotCIIAB03
start..stop
S start..stop
ApruCIIAB01 357 8e-125 1..312 1..296
RrufCIIAB02 306 4e-104 1..312 1..316
CberCIIAB01 303 4e-103 1..312 1..314
HpulCIIAB01 301 2e-102 1..312 1..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12837..13251 415 N° 2 13307..13709 403 N° 3 13764..13884 121  
join(12837..13251,13307..13709,13764..13884)


exon

Literature and cross-references BdotCIIAB03
DNA ref. JGI genome:   NODE_2788_length_75143_cov_62.042679 (12837..13884)
Cluster/Prediction ref. JGI gene:   7249
Protein sequence: BdotCIIAB03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (293)
PWM (Da):   %s   32731.33 (30759.3)  
PI (pH):   %s   4.93 (4.69) Peptide Signal:   %s   cut: 20 range:20-312
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHFSKSSILLLSATASVQALTFSDVSSAASVLKREASDLSNNLLSLVKRQSSCPAVWTDVASELKGWFLDGSVCSDDARAAIRLSFHDCFSGGCDGSIILAQEYTRSDNAGLASFAQKLAPLADQYDVGTADLIQFAGALATATCPLGPRIAVKVGRKDSSTPSEEGQLPSARSDASTLIEQFSAKGFSQTDLVALVGAHSTAKQFFDQPDKAGESLDTTPGTWDTNFYRQTTLGTAPVTLQSDKNLAKDIRTSAQWTAFNAQGVWAAAFVSAMNKMTVLGNDVGSLTDCTNAISAATSKRDIKAAPIADRI

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTTCTCCAAGTCCTCCATCCTTCTTCTCTCGGCCACGGCCAGTGTCCAGGCTCTCACCTTCTCCGACGTCTCCTCTGCCGCTTCGGTGCTGAAGCGCGAGGCCTCTGATCTGAGC
AATAACCTTCTCTCTCTCGTTAAGCGCCAGAGCTCGTGCCCTGCTGTCTGGACAGATGTCGCCTCGGAGTTGAAGGGTTGGTTCCTGGACGGTTCCGTGTGCAGCGATGATGCGCGTGCG
GCCATCCGTCTTTCCTTCCACGACTGCTTCTCCGGCGGCTGTGATGGCTCCATTATCCTGGCTCAAGAGTACACTCGCTCTGATAATGCCGGCCTTGCGTCTTTTGCCCAGAAGCTGGCG
CCTCTGGCGGATCAGTACGATGTTGGAACTGCGGATTTGATCCAGTTTGCTGGTG
GTGCGTTTACACACCTCCAATCGTTCAAGAGAATTTCTAACAATAATTTTAACAGCTCTCGCCAC
TGCCACCTGCCCTCTTGGTCCCCGCATCGCCGTCAAGGTTGGCCGCAAGGACTCCTCCACCCCTTCAGAAGAAGGCCAGCTCCCGTCTGCCCGCTCGGATGCGTCGACCCTGATCGAACA
GTTTTCCGCCAAGGGCTTCAGCCAAACCGACCTTGTCGCCCTCGTCGGCGCGCACAGCACGGCCAAGCAGTTCTTCGACCAGCCCGACAAGGCCGGCGAGAGCTTGGACACCACGCCCGG
CACCTGGGACACCAACTTCTACCGTCAGACCACTCTGGGCACCGCACCCGTCACGCTCCAGAGTGACAAGAACCTTGCCAAGGATATCAGGACCAGCGCCCAATGGACCGCGTTCAACGC
CCAGGGCGTGTGGGCGGCAGCGTTCGTGAGCGC
GTAAGTTGCAAATAATGCCGAGGTGTTTCGAAACGGAAACTGACAAGATTACAGAATGAACAAAATGACCGTTCTGGGCAACGATGT
TGGTAGCTTGACAGACTGCACGAACGCCATCAGCGCGGCGACGAGCAAGCGCGATATCAAGGCCGCACCAATTGCGGACAGGATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTTCTCCAAGTCCTCCATCCTTCTTCTCTCGGCCACGGCCAGTGTCCAGGCTCTCACCTTCTCCGACGTCTCCTCTGCCGCTTCGGTGCTGAAGCGCGAGGCCTCTGATCTGAGC
AATAACCTTCTCTCTCTCGTTAAGCGCCAGAGCTCGTGCCCTGCTGTCTGGACAGATGTCGCCTCGGAGTTGAAGGGTTGGTTCCTGGACGGTTCCGTGTGCAGCGATGATGCGCGTGCG
GCCATCCGTCTTTCCTTCCACGACTGCTTCTCCGGCGGCTGTGATGGCTCCATTATCCTGGCTCAAGAGTACACTCGCTCTGATAATGCCGGCCTTGCGTCTTTTGCCCAGAAGCTGGCG
CCTCTGGCGGATCAGTACGATGTTGGAACTGCGGATTTGATCCAGTTTGCTGGTG
CTCTCGCCACTGCCACCTGCCCTCTTGGTCCCCGCATCGCCGTCAAGGTTGGCCGCAAGGACTCC
TCCACCCCTTCAGAAGAAGGCCAGCTCCCGTCTGCCCGCTCGGATGCGTCGACCCTGATCGAACAGTTTTCCGCCAAGGGCTTCAGCCAAACCGACCTTGTCGCCCTCGTCGGCGCGCAC
AGCACGGCCAAGCAGTTCTTCGACCAGCCCGACAAGGCCGGCGAGAGCTTGGACACCACGCCCGGCACCTGGGACACCAACTTCTACCGTCAGACCACTCTGGGCACCGCACCCGTCACG
CTCCAGAGTGACAAGAACCTTGCCAAGGATATCAGGACCAGCGCCCAATGGACCGCGTTCAACGCCCAGGGCGTGTGGGCGGCAGCGTTCGTGAGCGC
AATGAACAAAATGACCGTTCTG
GGCAACGATGTTGGTAGCTTGACAGACTGCACGAACGCCATCAGCGCGGCGACGAGCAAGCGCGATATCAAGGCCGCACCAATTGCGGACAGGATTTGA

Retrieve as FASTA