Entry information : PterCIIAA02
Entry ID 10536
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-12-21 (Marcel Zamocky)
Peroxidase information: PterCIIAA02
Name PterCIIAA02
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora teres    [TaxId: 53485 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PterCIIAA02
start..stop
S start..stop
PtritCIIAA02 812 0 1..399 1..399
AalteCIIAA01 766 0 1..400 1..400
AbraCIIAA 741 0 1..400 1..400
SturCIIAA02 741 0 1..400 1..400
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14405..15394 990 N° 2 15462..15674 213  
join(14405..15394,15462..15674)


exon

Literature and cross-references PterCIIAA02
Protein ref. UniProtKB:   E3S063
DNA ref. JGI genome:   192548 (14405..15674)
Cluster/Prediction ref. JGI gene:   7516
Protein sequence: PterCIIAA02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   401 (380)
PWM (Da):   %s   43843.89 (41451.6)  
PI (pH):   %s   7.79 (7.83) Peptide Signal:   %s   cut: 21 range:21-400
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRFLSYFSHALLACIPLTEAHPGMGDTMTEMRYLAAREKRQAAKELIGDLKTLADSKLTAIGKDIKAIILDQKSAESSTIDGSIPAGNIGSAACKADMCCHWKWLAYEMTAKFNGTSGRCSKFARQAVRLGFHDAAVWSKSTSYGGADGSILLSDEMSRADNNGLADIADQTKKWYTKYNQYGMSMADIIQFGANVATVVCPLGPRLRTFVGRKDNSKAGPTGMLPGEKDSADKLIKLFSDKTIDAHDLVALVGAHTTSQQHFINTARSGDPQDSTPGIWDMAFYPQTMGNPPVRVIKFQSDINLSKDSRTSPSWTQFSDRNTAQGRWNSDYAKAYTRLSILGVNNINDLKECTKVLPPARPTFVSEDQVLLDRWLNGEFDQLNDLVDNAIQLTGVISSK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTCTGTCCTACTTCAGTCATGCCCTTTTGGCATGTATCCCTCTCACTGAAGCCCATCCAGGCATGGGCGACACGATGACCGAGATGCGCTATCTAGCTGCTCGCGAGAAGCGT
CAAGCCGCCAAGGAGCTCATCGGAGATCTCAAGACCCTCGCAGACTCCAAGCTCACAGCCATTGGCAAGGACATCAAAGCCATCATACTAGACCAGAAGTCTGCCGAGTCATCTACCATT
GATGGTTCAATCCCCGCCGGTAACATCGGAAGCGCAGCCTGCAAAGCTGACATGTGCTGCCACTGGAAATGGCTGGCATACGAAATGACTGCAAAGTTCAACGGGACCTCCGGCCGCTGC
AGCAAGTTCGCACGCCAAGCTGTACGTCTAGGTTTCCACGATGCAGCCGTATGGTCCAAGAGCACCAGTTACGGCGGTGCAGATGGTAGTATCCTCCTCAGCGACGAAATGTCCCGAGCA
GACAATAACGGACTCGCCGATATCGCGGACCAGACAAAGAAATGGTACACCAAATACAACCAATACGGCATGAGCATGGCCGACATCATCCAATTCGGCGCCAACGTCGCAACCGTCGTG
TGCCCCCTTGGCCCTCGCCTCCGCACATTTGTCGGCCGAAAAGACAACAGCAAAGCTGGGCCTACGGGCATGTTACCCGGTGAAAAGGACTCTGCCGATAAGCTCATCAAGCTCTTCTCC
GACAAGACAATCGATGCACACGACCTCGTCGCTCTAGTTGGCGCACATACGACATCCCAGCAGCATTTCATCAATACCGCGCGCTCAGGCGACCCCCAGGACTCTACACCGGGAATCTGG
GACATGGCGTTCTATCCTCAAACAATGGGCAACCCACCTGTTCGCGTCATCAAGTTTCAGAGCGACATCAATTTGAGCAAGGACTCGAGGACTAGTCCTTCGTGGACGCAGTTTAGTGAC
CGTAATACTGCGCAGGGACGGTGGAACTCG
GTATGTCTTCTCTCTTGTCTGCGGCGCGAAGAGGAACATAAGGTTCATAGCTAACCAACCATCCCAGGACTACGCTAAAGCATACACCCG
TCTCTCGATCCTTGGTGTCAACAACATCAACGATCTGAAAGAATGCACAAAGGTCCTGCCTCCTGCGCGACCGACCTTTGTTAGTGAAGACCAGGTGCTCCTTGACAGGTGGCTGAATGG
CGAGTTTGATCAATTGAATGATTTGGTGGACAATGCTATTCAGTTGACGGGTGTTATATCATCGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTCTGTCCTACTTCAGTCATGCCCTTTTGGCATGTATCCCTCTCACTGAAGCCCATCCAGGCATGGGCGACACGATGACCGAGATGCGCTATCTAGCTGCTCGCGAGAAGCGT
CAAGCCGCCAAGGAGCTCATCGGAGATCTCAAGACCCTCGCAGACTCCAAGCTCACAGCCATTGGCAAGGACATCAAAGCCATCATACTAGACCAGAAGTCTGCCGAGTCATCTACCATT
GATGGTTCAATCCCCGCCGGTAACATCGGAAGCGCAGCCTGCAAAGCTGACATGTGCTGCCACTGGAAATGGCTGGCATACGAAATGACTGCAAAGTTCAACGGGACCTCCGGCCGCTGC
AGCAAGTTCGCACGCCAAGCTGTACGTCTAGGTTTCCACGATGCAGCCGTATGGTCCAAGAGCACCAGTTACGGCGGTGCAGATGGTAGTATCCTCCTCAGCGACGAAATGTCCCGAGCA
GACAATAACGGACTCGCCGATATCGCGGACCAGACAAAGAAATGGTACACCAAATACAACCAATACGGCATGAGCATGGCCGACATCATCCAATTCGGCGCCAACGTCGCAACCGTCGTG
TGCCCCCTTGGCCCTCGCCTCCGCACATTTGTCGGCCGAAAAGACAACAGCAAAGCTGGGCCTACGGGCATGTTACCCGGTGAAAAGGACTCTGCCGATAAGCTCATCAAGCTCTTCTCC
GACAAGACAATCGATGCACACGACCTCGTCGCTCTAGTTGGCGCACATACGACATCCCAGCAGCATTTCATCAATACCGCGCGCTCAGGCGACCCCCAGGACTCTACACCGGGAATCTGG
GACATGGCGTTCTATCCTCAAACAATGGGCAACCCACCTGTTCGCGTCATCAAGTTTCAGAGCGACATCAATTTGAGCAAGGACTCGAGGACTAGTCCTTCGTGGACGCAGTTTAGTGAC
CGTAATACTGCGCAGGGACGGTGGAACTCG
GACTACGCTAAAGCATACACCCGTCTCTCGATCCTTGGTGTCAACAACATCAACGATCTGAAAGAATGCACAAAGGTCCTGCCTCCTGCG
CGACCGACCTTTGTTAGTGAAGACCAGGTGCTCCTTGACAGGTGGCTGAATGGCGAGTTTGATCAATTGAATGATTTGGTGGACAATGCTATTCAGTTGACGGGTGTTATATCATCGAAG
TAG

Retrieve as FASTA