Entry information : SturCIIAA02
Entry ID 10541
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: SturCIIAA02
Name SturCIIAA02
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Setosphaeria
Organism Setosphaeria turcica    [TaxId: 93612 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SturCIIAA02
start..stop
S start..stop
AalteCIIAA01 775 0 1..403 1..403
CheCIIAA05_C5 771 0 1..401 1..401
CheCIIAA05_C4 771 0 1..401 1..401
COsaCIIAA05 764 0 1..401 1..401
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 360472..361461 990 N° 2 360185..360406 222  
complement(join(360185..360406,360472..361461))


exon

Literature and cross-references SturCIIAA02
DNA ref. JGI genome:   scaffold_4 (361461..360185)
Cluster/Prediction ref. JGI gene:   21098
Protein sequence: SturCIIAA02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   404 (383)
PWM (Da):   %s   44253.06 (41980.9)  
PI (pH):   %s   6.26 (6.52) Peptide Signal:   %s   cut: 21 range:21-403
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKALSYFSYALLACVPLSDAHPSMDETMADMRYLAAREKRQASKELIGDLKTLADSKLTAIGKDIKAIILDQMAAESATMDSSIPVGNIGSAACKADLCCHWKWLAYEMTAKFNGTSGRCSKFARQAVRLGFHDAAVWSKSTSYGGADGSILLSDEMTRADNNGLSAIADQTKKWYTKYNPYGMSMADIIQFGANVATVVCPLGPRLRTFVGRKDNSKAGPTGLLPGEKDSADTLIKLFQDKTIDAHDLVALVGAHTTSQQHFVDTTRDGDPQDSTPGIWDMAFYPQVTNNAPPRVLKFQSDINLSKDSRTSGSWAQFSDRATAQGRWNADYAKAYTRLSLLGVNNINDLKECTKVLPAERKTFVSEDQVLLDRWLQGEFDQLNNLVDDAIQLTNVISTREEK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCTCTTTCATACTTTAGCTATGCCCTTCTGGCCTGCGTTCCTCTGAGCGACGCTCACCCCAGCATGGATGAAACCATGGCAGATATGCGCTACCTAGCCGCTCGCGAGAAGCGC
CAGGCTTCCAAAGAACTCATTGGCGATCTTAAAACCCTCGCTGACTCTAAGCTTACTGCTATCGGCAAGGATATCAAGGCGATTATCCTGGATCAAATGGCCGCCGAGTCCGCTACGATG
GACAGCTCGATTCCTGTGGGAAACATTGGAAGTGCAGCCTGCAAGGCTGACCTATGCTGCCATTGGAAGTGGCTCGCGTATGAAATGACAGCCAAGTTCAACGGTACTTCTGGTCGTTGC
AGCAAGTTTGCTCGTCAGGCTGTGCGTCTAGGCTTTCACGATGCAGCTGTCTGGTCCAAGAGCACCAGCTATGGTGGCGCAGACGGCAGCATCCTTCTTAGCGACGAAATGACGCGAGCC
GACAACAATGGTCTTTCCGCCATTGCCGACCAGACCAAAAAATGGTACACCAAATACAATCCGTATGGCATGAGTATGGCGGACATTATCCAATTCGGTGCCAACGTAGCGACTGTCGTG
TGCCCGCTCGGCCCACGCCTCCGCACCTTTGTTGGCCGCAAAGACAACAGCAAAGCGGGACCTACTGGGCTTCTCCCTGGAGAAAAGGACTCTGCGGATACGCTTATCAAGCTGTTCCAA
GACAAAACCATTGACGCGCATGACCTTGTGGCCCTTGTAGGCGCACACACAACGTCACAACAGCACTTTGTCGACACTACTCGTGATGGCGACCCGCAAGACTCAACGCCCGGTATATGG
GACATGGCGTTCTACCCGCAGGTCACGAACAACGCCCCTCCACGTGTGCTCAAGTTCCAGAGCGACATCAACTTGAGCAAGGATTCGAGGACGAGCGGGTCGTGGGCACAGTTCAGCGAT
AGGGCCACTGCACAGGGACGATGGAATGCG
GTAAGTGGTTTTTTTTTTCCAACTTTGCGCCTTGGAACAAACCCCGTGCTAACAGAGTGCAAAAGGACTATGCTAAAGCTTACACTCGGC
TCTCGTTGCTCGGCGTCAACAATATCAATGACCTCAAGGAATGCACAAAGGTTCTACCTGCTGAACGCAAGACATTCGTTAGCGAAGACCAAGTCTTGCTCGATAGGTGGCTTCAGGGCG
AATTCGACCAGCTGAATAATCTCGTCGACGATGCGATCCAGCTCACGAATGTGATATCAACGAGAGAGGAAAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCTCTTTCATACTTTAGCTATGCCCTTCTGGCCTGCGTTCCTCTGAGCGACGCTCACCCCAGCATGGATGAAACCATGGCAGATATGCGCTACCTAGCCGCTCGCGAGAAGCGC
CAGGCTTCCAAAGAACTCATTGGCGATCTTAAAACCCTCGCTGACTCTAAGCTTACTGCTATCGGCAAGGATATCAAGGCGATTATCCTGGATCAAATGGCCGCCGAGTCCGCTACGATG
GACAGCTCGATTCCTGTGGGAAACATTGGAAGTGCAGCCTGCAAGGCTGACCTATGCTGCCATTGGAAGTGGCTCGCGTATGAAATGACAGCCAAGTTCAACGGTACTTCTGGTCGTTGC
AGCAAGTTTGCTCGTCAGGCTGTGCGTCTAGGCTTTCACGATGCAGCTGTCTGGTCCAAGAGCACCAGCTATGGTGGCGCAGACGGCAGCATCCTTCTTAGCGACGAAATGACGCGAGCC
GACAACAATGGTCTTTCCGCCATTGCCGACCAGACCAAAAAATGGTACACCAAATACAATCCGTATGGCATGAGTATGGCGGACATTATCCAATTCGGTGCCAACGTAGCGACTGTCGTG
TGCCCGCTCGGCCCACGCCTCCGCACCTTTGTTGGCCGCAAAGACAACAGCAAAGCGGGACCTACTGGGCTTCTCCCTGGAGAAAAGGACTCTGCGGATACGCTTATCAAGCTGTTCCAA
GACAAAACCATTGACGCGCATGACCTTGTGGCCCTTGTAGGCGCACACACAACGTCACAACAGCACTTTGTCGACACTACTCGTGATGGCGACCCGCAAGACTCAACGCCCGGTATATGG
GACATGGCGTTCTACCCGCAGGTCACGAACAACGCCCCTCCACGTGTGCTCAAGTTCCAGAGCGACATCAACTTGAGCAAGGATTCGAGGACGAGCGGGTCGTGGGCACAGTTCAGCGAT
AGGGCCACTGCACAGGGACGATGGAATGCG
GACTATGCTAAAGCTTACACTCGGCTCTCGTTGCTCGGCGTCAACAATATCAATGACCTCAAGGAATGCACAAAGGTTCTACCTGCTGAA
CGCAAGACATTCGTTAGCGAAGACCAAGTCTTGCTCGATAGGTGGCTTCAGGGCGAATTCGACCAGCTGAATAATCTCGTCGACGATGCGATCCAGCTCACGAATGTGATATCAACGAGA
GAGGAAAAGTAA

Retrieve as FASTA