Entry information : COsaCIIAC04
Entry ID 10543
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: COsaCIIAC04
Name COsaCIIAC04
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus sativus    [TaxId: 45130 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value COsaCIIAC04
start..stop
S start..stop
CheCIIAC04_C5 688 0 1..347 1..347
CheCIIAC04_C4 688 0 1..347 1..347
ClunCIIAC01 546 0 1..347 1..346
SturCIIAC01 508 0 18..347 12..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3011441..3011678 238 N° 2 3010584..3011389 806  
complement(join(3010584..3011389,3011441..3011678))


exon

Literature and cross-references COsaCIIAC04
DNA ref. JGI genome:   scaffold_2 (3011678..3010584)
Cluster/Prediction ref. JGI gene:   135272
Protein sequence: COsaCIIAC04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (327)
PWM (Da):   %s   38098.17 (35903.0)  
PI (pH):   %s   7.21 (6.94) Peptide Signal:   %s   cut: 21 range:21-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFKAALMFSLLGLSLFASAGPLQQREALFNILEAELGGSFNEIGQLVQDIVGGNKPATDNNQRPKPPKCDQKKDQCCVWYDVSAELTQLFVGQDKECNDNARAAVRMGFHDAGSWDESSSHGGADGSLIMDFGEHDRRENNGLQNVRTLLRGVRDKYKVGYADLVQYAHNHATVSCPKGPRVRTFVGRLDATKANPIGLLPDTHDDPDNLIALFKRKGISERDLAALVGAHATARQRFVDKSSAAVSKPLDSTPGVWDVEFYNDTLNNPVGATAEQKVFVLPSDKALSQHPKTSGDWRRFVGNQGGWNADYARAYIKVSLFGVKQEQLAKMVDCTQTLPLSRDIFP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAAGGCAGCTCTGATGTTTTCCCTTCTTGGGCTTTCCCTCTTTGCGTCAGCAGGGCCCTTGCAACAGCGGGAGGCTCTATTCAATATACTTGAAGCCGAGCTTGGTGGTAGC
TTCAACGAAATCGGGCAGCTTGTCCAGGACATCGTTGGCGGCAACAAGCCTGCGACCGACAACAACCAGAGACCAAAACCTCCCAAATGTGATCAGAAAAAAGATCAATGCTGCGTGT
GT
AAGTTGACCAAAGCATGTCTTTGGTGCATTGCAGACTGACAGACAACAGGGTACGACGTTTCTGCAGAGTTAACCCAGCTTTTTGTTGGGCAAGATAAGGAGTGTAACGACAATGCTCGA
GCAGCTGTCCGCATGGGTTTCCACGATGCAGGGTCCTGGGACGAGAGCTCCAGCCACGGTGGTGCCGACGGGTCGCTAATCATGGATTTCGGCGAGCATGACCGTCGTGAAAACAACGGT
CTTCAAAATGTACGCACACTGCTACGCGGGGTGCGGGACAAGTACAAGGTGGGATATGCTGATCTTGTGCAATACGCTCATAACCACGCCACCGTTTCCTGTCCGAAAGGACCGCGTGTG
CGTACCTTTGTCGGACGGTTGGACGCCACCAAGGCCAACCCGATAGGCCTTTTGCCAGACACTCATGATGACCCTGACAACCTGATTGCTTTGTTCAAGAGGAAGGGCATTTCTGAACGC
GATCTAGCAGCTCTGGTGGGTGCTCACGCAACAGCGCGTCAGCGCTTTGTCGACAAGTCATCAGCAGCGGTCAGTAAGCCCCTCGACTCTACTCCTGGTGTATGGGATGTAGAGTTCTAT
AATGATACGCTCAACAACCCTGTTGGTGCTACGGCTGAGCAAAAAGTCTTTGTCCTTCCCAGCGACAAAGCGCTGTCCCAACACCCCAAGACTAGTGGCGACTGGCGCAGATTCGTTGGA
AACCAGGGCGGGTGGAACGCAGACTATGCCCGAGCTTACATCAAGGTGAGCCTGTTCGGGGTCAAGCAGGAGCAGTTGGCCAAGATGGTGGACTGTACCCAGACGCTGCCTCTTAGCCGA
GACATATTTCCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAAGGCAGCTCTGATGTTTTCCCTTCTTGGGCTTTCCCTCTTTGCGTCAGCAGGGCCCTTGCAACAGCGGGAGGCTCTATTCAATATACTTGAAGCCGAGCTTGGTGGTAGC
TTCAACGAAATCGGGCAGCTTGTCCAGGACATCGTTGGCGGCAACAAGCCTGCGACCGACAACAACCAGAGACCAAAACCTCCCAAATGTGATCAGAAAAAAGATCAATGCTGCGTGT
GG
TACGACGTTTCTGCAGAGTTAACCCAGCTTTTTGTTGGGCAAGATAAGGAGTGTAACGACAATGCTCGAGCAGCTGTCCGCATGGGTTTCCACGATGCAGGGTCCTGGGACGAGAGCTCC
AGCCACGGTGGTGCCGACGGGTCGCTAATCATGGATTTCGGCGAGCATGACCGTCGTGAAAACAACGGTCTTCAAAATGTACGCACACTGCTACGCGGGGTGCGGGACAAGTACAAGGTG
GGATATGCTGATCTTGTGCAATACGCTCATAACCACGCCACCGTTTCCTGTCCGAAAGGACCGCGTGTGCGTACCTTTGTCGGACGGTTGGACGCCACCAAGGCCAACCCGATAGGCCTT
TTGCCAGACACTCATGATGACCCTGACAACCTGATTGCTTTGTTCAAGAGGAAGGGCATTTCTGAACGCGATCTAGCAGCTCTGGTGGGTGCTCACGCAACAGCGCGTCAGCGCTTTGTC
GACAAGTCATCAGCAGCGGTCAGTAAGCCCCTCGACTCTACTCCTGGTGTATGGGATGTAGAGTTCTATAATGATACGCTCAACAACCCTGTTGGTGCTACGGCTGAGCAAAAAGTCTTT
GTCCTTCCCAGCGACAAAGCGCTGTCCCAACACCCCAAGACTAGTGGCGACTGGCGCAGATTCGTTGGAAACCAGGGCGGGTGGAACGCAGACTATGCCCGAGCTTACATCAAGGTGAGC
CTGTTCGGGGTCAAGCAGGAGCAGTTGGCCAAGATGGTGGACTGTACCCAGACGCTGCCTCTTAGCCGAGACATATTTCCTTAG

Retrieve as FASTA