Entry information : COsaCIIAA05
Entry ID 10544
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2017-05-22 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-05-22 (Catherine Mathe)
Peroxidase information: COsaCIIAA05
Name COsaCIIAA05
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus sativus    [TaxId: 45130 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value COsaCIIAA05
start..stop
S start..stop
CheCIIAA05_C5 823 0 1..404 1..404
CheCIIAA05_C4 823 0 1..404 1..404
AalteCIIAA01 770 0 1..404 1..404
SturCIIAA02 764 0 1..401 1..401
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 211374..212363 990 N° 2 211097..211321 225  
complement(join(211097..211321,211374..212363))


exon

Literature and cross-references COsaCIIAA05
DNA ref. JGI genome:   scaffold_6 (212363..211097)
Cluster/Prediction ref. JGI gene:   115559 [Incorrect prediction]
Protein sequence: COsaCIIAA05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   404 (384)
PWM (Da):   %s   44213.14 (41933.9)  
PI (pH):   %s   7.09 (7.46) Peptide Signal:   %s   cut: 21 range:21-404
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKALSYLSYALLAYIPLAEAHPGMGDTMAEMRYLAAREKRQTSKELIGDLKTLADSKLTAIGKDIKAIILDQKSAESTVIDKSIPVGNIGSAACKADLCCHWKWLAYEMTAKFNGTSGRCNKFARQAVRLGFHDAGVWSKSSGYGGADGSILLSDEMTRTDNNGLAAIADQTKKWYTKYNQYGMSMADIIQFGANVATVVCPLGPRLRTFVGRKDNSKAGPTGLLPGEKDSADKLIKMFQDKTIDAHDLVALVGAHTTSQQHFVDTSRDGDPQDSTPGVWDMAFYPQTTNNAPPRVLKFQSDINLSKDSRTSTSWAQFSDRATAQGRWNADYAKAYTRLSLLGVNNINDLKECTGVLPAERTSFVNQDQIVLDRWLQGEFDQLNNLVDDAIQLTGVISGRDAEP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Incorrect prediction from JGI (peptide signal missing)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCTCTCTCCTACCTCAGTTATGCCCTTCTGGCATACATCCCCCTGGCCGAAGCTCACCCCGGCATGGGCGATACAATGGCCGAAATGCGCTACCTAGCCGCTCGCGAGAAGCGC
CAGACTTCTAAAGAACTCATTGGTGATCTCAAGACCCTCGCAGATTCTAAGCTTACAGCTATTGGCAAAGACATCAAAGCCATTATCCTGGACCAGAAGTCTGCCGAGTCAACAGTCATA
GACAAATCGATTCCAGTTGGCAACATCGGAAGTGCAGCCTGCAAAGCTGATTTGTGTTGCCACTGGAAGTGGCTCGCATATGAGATGACAGCCAAGTTCAACGGCACCTCCGGCCGTTGC
AACAAATTTGCCCGTCAAGCTGTGCGTCTGGGCTTCCACGATGCAGGTGTCTGGTCGAAGAGCAGCGGCTACGGTGGTGCAGACGGCAGTATTCTTCTTAGTGATGAAATGACGAGAACA
GACAATAATGGTCTTGCAGCCATCGCTGACCAGACAAAGAAGTGGTACACTAAATACAACCAGTATGGAATGAGCATGGCAGACATCATCCAGTTCGGCGCCAATGTCGCGACTGTCGTT
TGCCCGCTCGGCCCCCGTCTCCGCACCTTCGTTGGCCGCAAAGACAACAGCAAAGCGGGCCCCACTGGACTTTTGCCTGGGGAGAAGGACTCAGCAGATAAGCTCATCAAGATGTTTCAA
GATAAGACCATCGATGCCCATGACCTCGTAGCCCTGGTAGGCGCACACACCACGTCGCAGCAGCACTTTGTCGACACCAGTCGCGACGGCGACCCACAAGACTCGACACCCGGTGTATGG
GATATGGCCTTCTACCCCCAGACAACCAACAACGCACCGCCTCGTGTCCTCAAGTTCCAAAGCGATATCAACTTGAGCAAGGACTCGAGAACAAGTACATCCTGGGCGCAGTTCAGCGAC
AGGGCTACTGCACAAGGAAGGTGGAATGCG
GCAAGTATTTCCAATCATTCTGTTCGAGAATTCAAACTGACAAAAGGATCAGGACTATGCCAAAGCTTACACGCGTCTGTCGTTGCTCGG
TGTCAACAACATCAATGATCTCAAGGAATGCACTGGTGTCCTGCCTGCTGAGCGCACATCATTCGTCAACCAAGACCAAATTGTGCTGGATAGGTGGCTACAAGGAGAGTTTGATCAGCT
CAATAACCTGGTGGATGACGCTATTCAGTTGACTGGTGTCATCTCGGGTAGGGATGCGGAACCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCTCTCTCCTACCTCAGTTATGCCCTTCTGGCATACATCCCCCTGGCCGAAGCTCACCCCGGCATGGGCGATACAATGGCCGAAATGCGCTACCTAGCCGCTCGCGAGAAGCGC
CAGACTTCTAAAGAACTCATTGGTGATCTCAAGACCCTCGCAGATTCTAAGCTTACAGCTATTGGCAAAGACATCAAAGCCATTATCCTGGACCAGAAGTCTGCCGAGTCAACAGTCATA
GACAAATCGATTCCAGTTGGCAACATCGGAAGTGCAGCCTGCAAAGCTGATTTGTGTTGCCACTGGAAGTGGCTCGCATATGAGATGACAGCCAAGTTCAACGGCACCTCCGGCCGTTGC
AACAAATTTGCCCGTCAAGCTGTGCGTCTGGGCTTCCACGATGCAGGTGTCTGGTCGAAGAGCAGCGGCTACGGTGGTGCAGACGGCAGTATTCTTCTTAGTGATGAAATGACGAGAACA
GACAATAATGGTCTTGCAGCCATCGCTGACCAGACAAAGAAGTGGTACACTAAATACAACCAGTATGGAATGAGCATGGCAGACATCATCCAGTTCGGCGCCAATGTCGCGACTGTCGTT
TGCCCGCTCGGCCCCCGTCTCCGCACCTTCGTTGGCCGCAAAGACAACAGCAAAGCGGGCCCCACTGGACTTTTGCCTGGGGAGAAGGACTCAGCAGATAAGCTCATCAAGATGTTTCAA
GATAAGACCATCGATGCCCATGACCTCGTAGCCCTGGTAGGCGCACACACCACGTCGCAGCAGCACTTTGTCGACACCAGTCGCGACGGCGACCCACAAGACTCGACACCCGGTGTATGG
GATATGGCCTTCTACCCCCAGACAACCAACAACGCACCGCCTCGTGTCCTCAAGTTCCAAAGCGATATCAACTTGAGCAAGGACTCGAGAACAAGTACATCCTGGGCGCAGTTCAGCGAC
AGGGCTACTGCACAAGGAAGGTGGAATGCG
GACTATGCCAAAGCTTACACGCGTCTGTCGTTGCTCGGTGTCAACAACATCAATGATCTCAAGGAATGCACTGGTGTCCTGCCTGCTGAG
CGCACATCATTCGTCAACCAAGACCAAATTGTGCTGGATAGGTGGCTACAAGGAGAGTTTGATCAGCTCAATAACCTGGTGGATGACGCTATTCAGTTGACTGGTGTCATCTCGGGTAGG
GATGCGGAACCGTAG

Retrieve as FASTA