Entry information : AalcCIIAA
Entry ID 10547
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AalcCIIAA
Name AalcCIIAA
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Acremonium
Organism Acremonium alcalophilum    [TaxId: 398408 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AalcCIIAA
start..stop
S start..stop
VaaCIIAA02 498 4e-177 6..394 5..399
VdaCIIAA02 491 1e-174 6..394 5..399
CgloCIIAA01_ST23 407 2e-141 1..395 1..402
CgloCIIAA01_Naragc5 407 3e-141 1..395 1..402
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2668907..2669887 981 N° 2 2668536..2668742 207  
complement(join(2668536..2668742,2668907..2669887))


exon

Literature and cross-references AalcCIIAA
DNA ref. JGI genome:   scaffold_1 (2669887..2668536)
Cluster/Prediction ref. JGI gene:   2095732 [Incorrect prediction]
Protein sequence: AalcCIIAA
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   396 (377)
PWM (Da):   %s   42445.77 (40479.8)  
PI (pH):   %s   4.79 (4.72) Peptide Signal:   %s   cut: 19 range:19-395
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTSPFLAVACTAGFTLAYPGMDKTMSDIQARQGGSGRSTALLGDLIHLSDRRLTRTGREIKAILSGTGNPQDLTSSYILGAPPLGSWLCDIDTCCVWKHIADEMAPALTGSAGRCNDLARALIRLGFHDAGTWDIHSEGTGADGSIALTDECNRTPENNGLGTACDQVRAWHAKYASHGVSMADVIQFAAQVATVVCPLGPRIRFFAGRKDVAVEGPRGLLPGPFDDADRIIEMFANKTISTGGIVALLGAHSASQQHTVDVDRAGDPQDSTPGVWDTDYFSETLDTDAPSRVFKFQSDINIANDPRTHATWRSYADPSAQSSWNEAYAAEYIRVSLLGVPKLNTMTECSRALPPFRGTFEAPDQSQLDRFMQGLLDTATDVLYNGDSIPADLQ*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Incorrect prediction from JGI (20 aa are missing in 5').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACTTCGCCTTTCCTCGCGGTCGCCTGCACCGCCGGCTTCACATTAGCCTACCCGGGCATGGACAAAACCATGTCCGACATCCAGGCCCGACAAGGCGGCAGCGGCCGCTCGACC
GCCCTGCTAGGCGACCTCATCCATCTTTCCGACCGTCGACTCACCCGCACCGGACGCGAGATCAAAGCCATTCTCTCCGGCACCGGCAACCCGCAGGACCTAACCTCGTCCTACATCCTC
GGCGCCCCTCCCCTCGGCTCGTGGCTCTGCGACATCGACACCTGCTGCGTCTGGAAACACATCGCCGACGAGATGGCCCCCGCCCTAACCGGCTCCGCGGGACGCTGCAACGACCTCGCC
CGCGCCCTCATCCGGCTCGGCTTCCACGACGCCGGCACCTGGGACATCCACTCCGAGGGCACCGGCGCCGACGGCTCCATCGCCCTGACGGACGAGTGCAACCGCACCCCGGAGAACAAC
GGGCTCGGCACCGCCTGCGACCAAGTGCGCGCCTGGCACGCAAAGTACGCGAGCCACGGCGTCTCCATGGCCGACGTGATCCAGTTCGCCGCCCAGGTCGCCACCGTCGTCTGCCCGCTG
GGCCCACGCATCCGCTTCTTCGCCGGCCGGAAGGATGTCGCCGTCGAGGGTCCCCGTGGCTTGCTGCCGGGGCCCTTTGACGACGCCGACAGGATCATCGAAATGTTCGCCAACAAGACC
ATCTCCACCGGCGGCATCGTGGCCCTTCTGGGCGCCCACAGCGCATCGCAGCAGCACACCGTCGACGTGGACCGCGCCGGCGACCCGCAGGACTCTACGCCGGGCGTCTGGGATACCGAC
TACTTTTCCGAAACCCTCGACACGGACGCCCCCTCTCGCGTCTTCAAGTTCCAGAGCGACATCAATATCGCCAACGACCCCCGCACTCACGCTACCTGGAGGTCTTACGCTGATCCTTCG
GCGCAGTCCAGCTGGAATGAG
GTTAGTTGGTCGATTCTTCTCTTCACTCCGCCCGCTTCCCCCCTTCTTCTTCTGTTTTTCTTCTCTTTCCCCTTTTTCTTTGCCCTTGCCTCCTTCCAC
CCGGTCCTATCTAATCATTATCCTGCCCATTACTGTTCCACATATACTAACAGTCTTTCAAAAAGGCCTATGCAGCGGAGTATATCCGCGTCAGCCTCCTTGGTGTCCCCAAGCTCAACA
CCATGACCGAGTGCAGCCGTGCCCTGCCCCCCTTCCGCGGCACTTTTGAGGCGCCTGACCAGTCTCAACTCGATCGCTTCATGCAAGGTCTGCTCGACACGGCCACCGACGTCCTCTACA
ACGGCGATTCTATCCCCGCGGATTTGCAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACTTCGCCTTTCCTCGCGGTCGCCTGCACCGCCGGCTTCACATTAGCCTACCCGGGCATGGACAAAACCATGTCCGACATCCAGGCCCGACAAGGCGGCAGCGGCCGCTCGACC
GCCCTGCTAGGCGACCTCATCCATCTTTCCGACCGTCGACTCACCCGCACCGGACGCGAGATCAAAGCCATTCTCTCCGGCACCGGCAACCCGCAGGACCTAACCTCGTCCTACATCCTC
GGCGCCCCTCCCCTCGGCTCGTGGCTCTGCGACATCGACACCTGCTGCGTCTGGAAACACATCGCCGACGAGATGGCCCCCGCCCTAACCGGCTCCGCGGGACGCTGCAACGACCTCGCC
CGCGCCCTCATCCGGCTCGGCTTCCACGACGCCGGCACCTGGGACATCCACTCCGAGGGCACCGGCGCCGACGGCTCCATCGCCCTGACGGACGAGTGCAACCGCACCCCGGAGAACAAC
GGGCTCGGCACCGCCTGCGACCAAGTGCGCGCCTGGCACGCAAAGTACGCGAGCCACGGCGTCTCCATGGCCGACGTGATCCAGTTCGCCGCCCAGGTCGCCACCGTCGTCTGCCCGCTG
GGCCCACGCATCCGCTTCTTCGCCGGCCGGAAGGATGTCGCCGTCGAGGGTCCCCGTGGCTTGCTGCCGGGGCCCTTTGACGACGCCGACAGGATCATCGAAATGTTCGCCAACAAGACC
ATCTCCACCGGCGGCATCGTGGCCCTTCTGGGCGCCCACAGCGCATCGCAGCAGCACACCGTCGACGTGGACCGCGCCGGCGACCCGCAGGACTCTACGCCGGGCGTCTGGGATACCGAC
TACTTTTCCGAAACCCTCGACACGGACGCCCCCTCTCGCGTCTTCAAGTTCCAGAGCGACATCAATATCGCCAACGACCCCCGCACTCACGCTACCTGGAGGTCTTACGCTGATCCTTCG
GCGCAGTCCAGCTGGAATGAG
GCCTATGCAGCGGAGTATATCCGCGTCAGCCTCCTTGGTGTCCCCAAGCTCAACACCATGACCGAGTGCAGCCGTGCCCTGCCCCCCTTCCGCGGCACT
TTTGAGGCGCCTGACCAGTCTCAACTCGATCGCTTCATGCAAGGTCTGCTCGACACGGCCACCGACGTCCTCTACAACGGCGATTCTATCCCCGCGGATTTGCAGTGA

Retrieve as FASTA