Entry information : PcriCIIBA01
Entry ID 10548
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: PcriCIIBA01
Name PcriCIIBA01
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Plicaturopsis
Organism Plicaturopsis crispa    [TaxId: 139390 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcriCIIBA01
start..stop
S start..stop
HanCIIBB07 346 7e-119 39..348 35..343
LsulCIIBA01 344 4e-118 42..348 39..342
PcroCIIBA01 342 5e-117 52..348 70..366
ParcCIIBA04 338 8e-116 39..348 37..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 657543..657612 70 N° 2 657438..657490 53 N° 3 657352..657369 18 N° 4 657269..657294 26
N° 5 657105..657209 105 N° 6 657032..657045 14 N° 7 656929..656970 42 N° 8 656792..656870 79
N° 9 656438..656735 298 N° 10 656235..656379 145 N° 11 655999..656171 173 N° 12 655910..655942 33
complement(join(655910..655942,655999..656171,656235..656379,656438..656735,6567 92..656870,656929..656970,657032..657045,657105..657209,657269..657294,657352..6 57369,657438..657490,657543..657612))


exon

Literature and cross-references PcriCIIBA01
DNA ref. JGI genome:   scaffold_11 (657612..655910)
Cluster/Prediction ref. JGI gene:   177549
Protein sequence: PcriCIIBA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352 (327)
PWM (Da):   %s   36884.93 (34381.6)  
PI (pH):   %s   4.43 (4.37) Peptide Signal:   %s   cut: 25 range:25-351
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPSSTSIGLSFLPVACCAILSVRGAFLQPSTTNCPGSRNACCKWFNVLYDVQNNLFDGGVCGQDARSSIRLMFHDSVGLSKSLWSSGSFGGGGDGSIIKYSTTELAYTANIGLQDIVNALQSTADAHNVSYGDIIQFAGAIALTNCPGAPRIQFLAGRPDATAPAPPSTIAPAPFYTVDQILDRMADAGFSPDDTVALLASHSIGTQQTTDPTVPGAPFDSTPEVFDNQFYLMLLKGKTYPGSGNNQGEVKAPIHGQFRLQSDEAIARAPQTACKWASFAHDSHAMVDAFRDAMAKVANNGQNISELVDCSEVIPEGAGWKTPATLPAGHTVLDVEDCEESALPLPL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTCCTCCACGTCCATTGGATTAAGTTTCCTACCGGTCGCGTGTTGCGCTATACTTTCTGTTCGAGGTACGCACACTGGCCACGCCGTGTAGAAAAATGTTGAATCTTCTGCTTTT
AGGCGCGTTCCTGCAGCCCTCAACAACAAATTGCCCTGGTTCTCGAAACGCTGTTGTAAATGCACAGGCAAGTGTTCCGCGAACCTTCCAGGTTCTAAGAACTGACGGCGTGAACAATTC
CAGTGCTGCAAGTGGTTCAATGTGCGCTGAGACGTTCTGGAGATATGTGAGACAGTCTGCTAACAATTCCGTGCGCAGGTATTATACGATGTTCAAAATAATTTGTACGTTGGCGTTTCA
ATTCTAAAGCATCTACACATCATGACTATATCTCCGACCTCAGATTCGACGGCGGCGTATGCGGCCAAGATGCGAGGTCCTCGATCCGCCTAATGTTTCACGATAGTGTGGGCTTGTCCA
AGTCGCTTTGGTCTTCTGGATCGTTTGG
GTAAGTCCCATCCCCGTTCTATGCTCGAATAATCATGATGCTCATTCGTCCATCTGTAGAGGGGGCGGCGCAGGTACACATGAGCTCGTTCG
GAGTCTAGCTCTTCAGCTAATAGGTGCGCTGGTCATTCGTAGATGGGAGCATCATAAAATATTCGACAACGGAACTTGCGTATAGTACATATCTCCGTTGATTGATCTTTAGTGATATCG
TGCTGATAGTCTTCGTCGACAGCGGCCAATATCGGCCTTCAGGATATCGTCAACGCACTGCAATCCACCGCAGACGCACACAACGTCAGCTATGGCGATATGTAAATACCCCTCCCCTCG
CTTGTTAGCATCAAAATAACTCCCTTCCCAACTTTAGCATCCAGTTCGCAGGCGCAATCGCACTCACTAATTGCCCAGGGGCTCCAAGAATTCAATTTTTAGCTGGACGCCCAGACGCAA
CAGCACCTGCGCCGCCGAGCACAATAGCACCCGCACCTTTCTATACGGTCGATCAAATTCTTGACCGCATGGCAGACGCAGGATTCTCTCCTGACGATACTGTGGCGCTGCTGGCGTCGC
ACTCGATCGGTACACAGCAGACGACAGATCCCACAGTTCCGGGCGCACCGTTTGACTCAACTCCTGAAGTCTTTGATAATCAGTTCTATCTGGAG
GTGAGTTCATACAGTGACGGGATAG
TACTAATTACGACGGCTAATGCCGATTTTGCAGATGTTGCTGAAGGGTAAGACGTACCCGGGCAGTGGGAACAACCAAGGCGAAGTGAAAGCACCGATACATGGCCAATTTCGCCTGCAG
TCTGATGAGGCGATTGCTCGGGCACCGCAGACGGCGTGCAAATGGGCTTCGTTCGCCC
GTTGAGTGCCGTCTCTTTTGTATCTTTTAAAATGGCGTTTTCTTATGTTTTTTCATGTCTCA
GACGATTCTCACGCCATGGTGGATGCGTTCCGTGATGCCATGGCCAAAGTGGCCAATAACGGACAAAACATCAGTGAACTAGTCGATTGTTCTGAGGTTATCCCAGAAGGAGCAGGTTGG
AAAACCCCTGCGACACTTCCAGCGGGGCATACGGTATTAGATGTTGAAGATTCC
GTGAGTAAAGTTCATGACTATATTGCGACCAAGGCATTAATCGACGCACTGTATAGTGCGAGGAAT
CCGCTCTGCCTCTGCCGCTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTCCTCCACGTCCATTGGATTAAGTTTCCTACCGGTCGCGTGTTGCGCTATACTTTCTGTTCGAGGCGCGTTCCTGCAGCCCTCAACAACAAATTGCCCTGGTTCTCGAAACGCT
GTT
TGCTGCAAGTGGTTCAATGTATTATACGATGTTCAAAATAATTTATTCGACGGCGGCGTATGCGGCCAAGATGCGAGGTCCTCGATCCGCCTAATGTTTCACGATAGTGTGGGCTTG
TCCAAGTCGCTTTGGTCTTCTGGATCGTTTGG
AGGGGGCGGCGCAGATGGGAGCATCATAAAATATTCGACAACGGAACTTGCGTATACGGCCAATATCGGCCTTCAGGATATCGTCAAC
GCACTGCAATCCACCGCAGACGCACACAACGTCAGCTATGGCGATAT
CATCCAGTTCGCAGGCGCAATCGCACTCACTAATTGCCCAGGGGCTCCAAGAATTCAATTTTTAGCTGGACGC
CCAGACGCAACAGCACCTGCGCCGCCGAGCACAATAGCACCCGCACCTTTCTATACGGTCGATCAAATTCTTGACCGCATGGCAGACGCAGGATTCTCTCCTGACGATACTGTGGCGCTG
CTGGCGTCGCACTCGATCGGTACACAGCAGACGACAGATCCCACAGTTCCGGGCGCACCGTTTGACTCAACTCCTGAAGTCTTTGATAATCAGTTCTATCTGGAG
ATGTTGCTGAAGGGT
AAGACGTACCCGGGCAGTGGGAACAACCAAGGCGAAGTGAAAGCACCGATACATGGCCAATTTCGCCTGCAGTCTGATGAGGCGATTGCTCGGGCACCGCAGACGGCGTGCAAATGGGCT
TCGTTCGCCC
ACGATTCTCACGCCATGGTGGATGCGTTCCGTGATGCCATGGCCAAAGTGGCCAATAACGGACAAAACATCAGTGAACTAGTCGATTGTTCTGAGGTTATCCCAGAAGGA
GCAGGTTGGAAAACCCCTGCGACACTTCCAGCGGGGCATACGGTATTAGATGTTGAAGATTCC
TGCGAGGAATCCGCTCTGCCTCTGCCGCTGTGA

Retrieve as FASTA