Entry information : PcriCIIBB07
Entry ID 10554
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: PcriCIIBB07
Name PcriCIIBB07
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Plicaturopsis
Organism Plicaturopsis crispa    [TaxId: 139390 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcriCIIBB07
start..stop
S start..stop
PcriCIIBB05 617 0 1..359 1..358
PcriCIIBB06 588 0 1..359 1..365
PcriCIIBB03 585 0 1..359 1..364
HanCIIBB07 534 0 1..359 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 356822..356882 61 N° 2 356944..357074 131 N° 3 357137..357195 59 N° 4 357261..357596 336
N° 5 357657..357782 126 N° 6 357839..357908 70 N° 7 357970..358156 187 N° 8 358214..358310 97
N° 9 358365..358377 13  
join(356822..356882,356944..357074,357137..357195,357261..357596,357657..357782, 357839..357908,357970..358156,358214..358310,358365..358377)


exon

Literature and cross-references PcriCIIBB07
DNA ref. JGI genome:   scaffold_3 (356822..358377)
Cluster/Prediction ref. JGI gene:   461658
Protein sequence: PcriCIIBB07
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (338)
PWM (Da):   %s   37318.37 (35086.2)  
PI (pH):   %s   4.09 (4.05) Peptide Signal:   %s   cut: 22 range:22-359
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFQMLSAIVFALGAIHATTAAITKRVACPDGKNTATNAACCALFPILDDIQANLFDGGQCGEVHESLRLTFHDAIGFSPTLGGGGADGSIIIFDTVETAFHANAGIDDIVDAQKPFVMNHSTISVGDFIQFAGAVGVSNCPGAPQLEFLLGRPNATAPSPDLLVPEPFDSTDKILARFSDAGFTSDEVVALLASHSVAAADLVDPTIPGTPFDSTPEVFDTQFFIETQLRGTGFPGNGSNQGEVESPLAGEIRLQSDSLARDSRTACTWQSFVTDQAKMQSAFKSAMAKLAVVGQDTSKLIDCSEVIPTPKAVTTTPHLPAGLNLGDIEQACSTTPFPTISADPGPETSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCCAGATGCTCTCTGCTATCGTCTTTGCCTTGGGCGCCATCCACGCGACCACAGGTCTGCACACTCTACATATTTTTCCGACTATTGGAACTTGTTTTTTGACCTCTCTGTCC
AGCTGCGATCACTAAGCGCGTCGCTTGTCCCGATGGGAAAAACACGGCCACCAATGCGGCGTGCTGTGCTCTGTTCCCGATTCTGGACGACATTCAGGCAAACCTATTCGATGGGGGCCA
ATGCGGCGAGGAG
GTAACAAATTCTGCGGCCATACGAGTGACATTGCATTCTGACATTTTTCCATAATAACCTAGGTCCACGAATCTCTGCGGCTTACTTTCCACGATGCCATCGGGTTC
TCCCCGACTCTAGG
GTGGGTGGTCGTTGTCCCTCAAACCTCCATTTCCACCGTATACTCATATATGAATATCTTGACAGTGGTGGCGGGGCTGACGGCTCCATCATCATCTTCGACACCG
TCGAGACTGCATTCCACGCAAATGCCGGCATCGATGATATTGTCGACGCCCAGAAGCCATTCGTGATGAACCACAGCACCATCAGTGTCGGAGACTTCATCCAGTTCGCCGGCGCTGTTG
GTGTCAGCAACTGCCCCGGTGCCCCTCAGCTGGAGTTCCTCCTCGGACGCCCCAATGCCACAGCGCCCTCCCCGGACTTGCTCGTCCCGGAGCCGTTCGACTCGACCGACAAAATCCTTG
CGCGGTTTAGCGACGCAGGCTTTACCAGCGACGAGGTCGTAGCGCTGCTGGCTTC
GTGCGTATAACTTCATAGTAGTTTTCCATACGTTCCGAAGCTGATTGTGACTCTGTACAGTCACT
CGGTCGCTGCTGCCGACCTGGTTGACCCGACTATCCCCGGGACACCCTTCGATTCTACACCCGAAGTGTTCGACACGCAATTCTTCATCGAGACGCAACTTCGCGGGACAGGTTTCCCAG
G
GTGAGAGAGCTCTCATATCTACTAATCGCTGGAAAAGGTGCTAAACAGACATATAGAAATGGTAGCAACCAGGGTGAGGTCGAGTCCCCCCTCGCCGGTGAAATTCGTCTCCAGTCTGA
CTCTGAA
GTAATTATTCGGATCCCATTTCCTCCGAGAACTTGGCTCTGATGTTTTGTCACTCCTTCAGCTGGCCCGTGACTCGCGCACTGCTTGCACTTGGCAGTCGTTTGTGACCGACC
AGGCGAAGATGCAGTCCGCATTCAAGTCTGCCATGGCCAAGCTCGCCGTTGTCGGCCAGGACACCTCGAAGCTCATCGACTGCTCCGAGGTCATTCCTACCCCGAAGGCTGTGACCACGA
CACCGCATCTACCTG
GTAAGCGCTTCGTGTCGGTCTCGTTGAAGGCAGCACTCTGAAAGCAGGAATGAACAGCCGGTCTTAACTTGGGCGATATTGAACAAGCCTGCAGCACTACTCCGT
TCCCTACAATCTCTGCTGACCCTGGCCCAGAGACCTCGGTCGCACCAGT
GTGAGTTGCATGCCATTATCTGCCGGTTGCTGTTGTTGACTTTCACGGTTGCAGTCCTCCCTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCCAGATGCTCTCTGCTATCGTCTTTGCCTTGGGCGCCATCCACGCGACCACAGCTGCGATCACTAAGCGCGTCGCTTGTCCCGATGGGAAAAACACGGCCACCAATGCGGCG
TGCTGTGCTCTGTTCCCGATTCTGGACGACATTCAGGCAAACCTATTCGATGGGGGCCAATGCGGCGAGGAG
GTCCACGAATCTCTGCGGCTTACTTTCCACGATGCCATCGGGTTCTCC
CCGACTCTAGG
TGGTGGCGGGGCTGACGGCTCCATCATCATCTTCGACACCGTCGAGACTGCATTCCACGCAAATGCCGGCATCGATGATATTGTCGACGCCCAGAAGCCATTCGTGATG
AACCACAGCACCATCAGTGTCGGAGACTTCATCCAGTTCGCCGGCGCTGTTGGTGTCAGCAACTGCCCCGGTGCCCCTCAGCTGGAGTTCCTCCTCGGACGCCCCAATGCCACAGCGCCC
TCCCCGGACTTGCTCGTCCCGGAGCCGTTCGACTCGACCGACAAAATCCTTGCGCGGTTTAGCGACGCAGGCTTTACCAGCGACGAGGTCGTAGCGCTGCTGGCTTC
TCACTCGGTCGCT
GCTGCCGACCTGGTTGACCCGACTATCCCCGGGACACCCTTCGATTCTACACCCGAAGTGTTCGACACGCAATTCTTCATCGAGACGCAACTTCGCGGGACAGGTTTCCCAGG
AAATGGT
AGCAACCAGGGTGAGGTCGAGTCCCCCCTCGCCGGTGAAATTCGTCTCCAGTCTGACTCTGAA
CTGGCCCGTGACTCGCGCACTGCTTGCACTTGGCAGTCGTTTGTGACCGACCAGGCG
AAGATGCAGTCCGCATTCAAGTCTGCCATGGCCAAGCTCGCCGTTGTCGGCCAGGACACCTCGAAGCTCATCGACTGCTCCGAGGTCATTCCTACCCCGAAGGCTGTGACCACGACACCG
CATCTACCTG
CCGGTCTTAACTTGGGCGATATTGAACAAGCCTGCAGCACTACTCCGTTCCCTACAATCTCTGCTGACCCTGGCCCAGAGACCTCGGTCGCACCAGTTCCTCCCTCTTAA

Retrieve as FASTA