Entry information : HsubCIIBB03
Entry ID 10557
Creation 2012-02-28 (Christophe Dunand)
Last sequence changes 2012-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Catherine
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: HsubCIIBB03
Name HsubCIIBB03
Class Other class II peroxidase type B    [Orthogroup: CIIBB002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Strophariaceae Hypholoma
Organism Hypholoma sublateritium    [TaxId: 71945 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HsubCIIBB03
start..stop
S start..stop
HsubCIIBB10 735 0 1..370 1..370
HsubCIIBB02 720 0 1..370 1..370
HsubCIIBB09 684 0 1..370 1..370
HsubCIIBB05 607 0 1..366 1..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14441..14501 61 N° 2 14203..14389 187 N° 3 14001..14141 141 N° 4 13696..13941 246
N° 5 13607..13641 35 N° 6 13508..13556 49 N° 7 13379..13448 70 N° 8 13278..13323 46
N° 9 13145..13221 77 N° 10 12987..13085 99 N° 11 12866..12930 65 N° 12 12776..12812 37
complement(join(12776..12812,12866..12930,12987..13085,13145..13221,13278..13323 ,13379..13448,13508..13556,13607..13641,13696..13941,14001..14141,14203..14389,1 4441..14501))


exon

Literature and cross-references HsubCIIBB03
DNA ref. JGI genome:   scaffold_130 (14501..12776)
Cluster/Prediction ref. JGI gene:   48449
Protein sequence: HsubCIIBB03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (349)
PWM (Da):   %s   38311.2 (36109.0)  
PI (pH):   %s   4.22 (4.25) Peptide Signal:   %s   cut: 22 range:22-370
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFSAALSAFVLALPLLSVNAARTKRALCPDGKNTAVNKACCALFPVVDDIVDNLFTNECGDSAHGALRLVFHDAIGISPTAGGGGADGSIATFNATELTFPANLGIDDVLDDLGPFILKHANTVTPGDFIQLAGAVSLVQCPGAPRIPFFMGRALPKAASPPNLVPQPTDDITTILERFGSVGFSPAEVVAVVGGSHSVAGADDVVPNFQGIPFDQTPSQFTQIFVDVLLHGTNFTDGGGPQSGESETAIAGTVRLQSDGLARDPRTACTWQSFVNEQSKMAAAFGAGVLKLSFLGQNERLTDCSEVIPAAKPANFGPATFPPTKSIRDIDLSCDEAKFPDLRTEPGPAVTIAPIPQAVDSSGDDS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCGCTGCGCTCTCCGCATTTGTGCTTGCACTACCCCTTCTCTCGGTCAACGGTAGGCCCTACACTTTTATTTTAGTAGGAGTGTACTCATTATTATTTCCAGCTGCCAGG
ACCAAGCGCGCTTTGTGCCCGGACGGTAAAAACACTGCAGTCAACAAGGCGTGCTGTGCCCTGTTCCCTGTCGTCGATGACATAGTGGACAACCTTTTCACCAACGAATGCGGTGACTCG
GCCCACGGTGCCCTCCGTCTGGTTTTCCACGACGCCATTGGCATTTCTCCCACTGCTGG
GTTCGTCTAATCATACATTGGACGGGATATCACCAATATGCTAACATCTGAATGTACATAG

TGGTGGAGGTGCTGACGGATCTATTGCGACCTTCAACGCGACGGAACTGACCTTCCCTGCCAACCTCGGCATCGATGATGTCCTCGACGACCTTGGCCCGTTCATCCTTAAACACGCCAA
CACCGTCACTCCTGGAGACTT
GTAAGCAAAATAAATCTTCAACTGTTCTGCAGCGGCTGTTAACAGTATCCAATTTACAGCATCCAGCTCGCTGGAGCCGTGAGTCTGGTTCAGTGCCCG
GGTGCTCCCCGCATTCCGTTCTTCATGGGTCGTGCCCTACCCAAGGCCGCATCACCCCCCAACCTCGTTCCTCAGCCAACTGACGACATCACCACCATCCTCGAGCGCTTCGGCTCGGTC
GGATTCTCTCCCGCTGAGGTCGTCGCCGTTGTCGGTGGATCCCACAGTGTCGCCGGTGCCGATGACGTCGTGCCAAACTTCCAGGG
GTACGCCAAAGCATGCTTTTACTTTCTATTTCGA
TCCTACTGACCTTCTTCAAGAATCCCCTTCGATCAAACTCCCTCTCAGTTTGATAGTATGTCTATTCTTCTGCTTGCTTCGATATTCTATTAACATATGGTTTAGCTCAGATCTTCGTTG
ACGTGCTTCTCCACGGAACCAACTTCACCGACGG
GTAGGCAAAATCTTTCCTAAGTTCGGATTTGATATCGATTATACATGCTATACCTGCAGTGGAGGCCCCCAGTCTGGTGAATCCGA
GACTGCTATTGCTGGAACAGTGCGCTTGCAATCAGACGGACTT
GTTAGTTTCGTGAACAATATTTCACTATGACCATACTGAACACTGTGTACTACAGCTCGCTCGTGACCCAAGAACTG
CCTGCACATGGCAATCCTTCGTCA
GTGAGTAGTGATTTTTTTTCCCCCAAGACAAAATATTCATCCAACATGTAATGCAGACGAGCAATCTAAGATGGCCGCAGCCTTTGGCGCAGGTGT
CCTCAAGCTTTCCTTCCTGGGTCAGAACGAGCGCGAG
GTAATCAATGGGCTTCATTAAACCAGTTCCAGCGCCTTATATTTGCGGTGTACCCACAGTTGACCGACTGCAGCGAAGTCATC
CCGGCCGCCAAGCCCGCCAACTTTGGACCCGCTACTTTCCCGCCCACCAAGAGCATCCGCGACATCGACCTCTCT
GTGAGTCACACGTTCATACGGTAATATAGACCTGAATGCTCACAA
GTTTTTGATAGTGCGACGAGGCCAAGTTCCCCGACCTCCGTACTGAGCCAGGCCCAGCGGTTACCATCGCTCCCATGTGCGTTAACTCATATTCTTGTTTATGTATCGATTCTGACCTGT
ATCTGTTAGCCCCCAAGCTGTCGACAGCAGCGGCGACGACTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCGCTGCGCTCTCCGCATTTGTGCTTGCACTACCCCTTCTCTCGGTCAACGCTGCCAGGACCAAGCGCGCTTTGTGCCCGGACGGTAAAAACACTGCAGTCAACAAGGCG
TGCTGTGCCCTGTTCCCTGTCGTCGATGACATAGTGGACAACCTTTTCACCAACGAATGCGGTGACTCGGCCCACGGTGCCCTCCGTCTGGTTTTCCACGACGCCATTGGCATTTCTCCC
ACTGCTGG
TGGTGGAGGTGCTGACGGATCTATTGCGACCTTCAACGCGACGGAACTGACCTTCCCTGCCAACCTCGGCATCGATGATGTCCTCGACGACCTTGGCCCGTTCATCCTTAAA
CACGCCAACACCGTCACTCCTGGAGACTT
CATCCAGCTCGCTGGAGCCGTGAGTCTGGTTCAGTGCCCGGGTGCTCCCCGCATTCCGTTCTTCATGGGTCGTGCCCTACCCAAGGCCGCA
TCACCCCCCAACCTCGTTCCTCAGCCAACTGACGACATCACCACCATCCTCGAGCGCTTCGGCTCGGTCGGATTCTCTCCCGCTGAGGTCGTCGCCGTTGTCGGTGGATCCCACAGTGTC
GCCGGTGCCGATGACGTCGTGCCAAACTTCCAGGG
AATCCCCTTCGATCAAACTCCCTCTCAGTTTGATACTCAGATCTTCGTTGACGTGCTTCTCCACGGAACCAACTTCACCGACGGT
GGAGGCCCCCAGTCTGGTGAATCCGAGACTGCTATTGCTGGAACAGTGCGCTTGCAATCAGACGGACTT
CTCGCTCGTGACCCAAGAACTGCCTGCACATGGCAATCCTTCGTCAACGAG
CAATCTAAGATGGCCGCAGCCTTTGGCGCAGGTGTCCTCAAGCTTTCCTTCCTGGGTCAGAACGAGCGCGAG
TTGACCGACTGCAGCGAAGTCATCCCGGCCGCCAAGCCCGCCAACTTT
GGACCCGCTACTTTCCCGCCCACCAAGAGCATCCGCGACATCGACCTCTCT
TGCGACGAGGCCAAGTTCCCCGACCTCCGTACTGAGCCAGGCCCAGCGGTTACCATCGCTCCCATCCCC
CAAGCTGTCGACAGCAGCGGCGACGACTCTTAA

Retrieve as FASTA