Entry information : HsubCIIBB04
Entry ID 10558
Creation 2012-02-28 (Christophe Dunand)
Last sequence changes 2012-03-27 (Christophe Dunand)
Sequence status complete
Reviewer Catherine
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: HsubCIIBB04
Name HsubCIIBB04
Class Other class II peroxidase type B    [Orthogroup: CIIBB002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Strophariaceae Hypholoma
Organism Hypholoma sublateritium    [TaxId: 71945 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HsubCIIBB04
start..stop
S start..stop
HsubCIIBB06 615 0 1..364 1..364
HsubCIIBB08 613 0 1..362 1..361
HsubCIIBB07 596 0 1..364 1..364
HsubCIIBB01 569 0 1..365 1..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35927..35987 61 N° 2 36040..36167 128 N° 3 36217..36275 59 N° 4 36326..36466 141
N° 5 36522..36805 284 N° 6 36858..36903 46 N° 7 36958..37027 70 N° 8 37087..37209 123
N° 9 37271..37369 99 N° 10 37419..37483 65 N° 11 37539..37560 22  
join(35927..35987,36040..36167,36217..36275,36326..36466,36522..36805,36858..369 03,36958..37027,37087..37209,37271..37369,37419..37483,37539..37560)


exon

Literature and cross-references HsubCIIBB04
DNA ref. JGI genome:   scaffold_107 (35927..37560)
Cluster/Prediction ref. JGI gene:   296328
Protein sequence: HsubCIIBB04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (344)
PWM (Da):   %s   37753.84 (35585.6)  
PI (pH):   %s   4.02 (4.04) Peptide Signal:   %s   cut: 22 range:22-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFSAALSALVLALPILSVNALRTRRALCPDGINTAVNQACCALFPVVKDLQENLFEGECGDAHGALRLVFHDSIGISPTLGGGGADGSIATFNETELTFPANLGIDDVLDTLGPFLFKHSNVMTPGDFIQLAGAVSLVQCPGAPRIPFFMGRAHPIAASPPGLVPDPFDSVESIMTRFGEVGFLTAEEVVAVVGGSHSVAGADDIVPNQQGVPFDQTPSVFTQIFVDVQLRGTLFTGEGGQQGEVETAVAGTVRLQSDHLARDSATNCAWQSFVNNQPAMATAFGQGVLKLSLLGQNQNELTDCSEVIPAALPFTGGPATLPPGLTMNDIEQACATAAFPSLATQPGPPTTVPAIPQADDS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCGCTGCTCTCTCCGCCCTCGTTCTCGCTCTTCCTATCCTCTCGGTCAATGGCAAGTTTATTTCCGAACGCTTATATATTTGGCGTGCTAATTATCTTTGAAGCTCTGAG
GACCAGGCGCGCGCTGTGCCCCGACGGCATCAACACCGCTGTTAACCAGGCCTGCTGTGCCCTGTTCCCCGTCGTCAAAGACCTCCAGGAAAACCTCTTTGAAGGCGAATGTGGTGACGC
T
GTCGGTGTTCCTTTTTTCCCTATAATGAAATTATCTAAGATATTCTTAGGCCCACGGTGCTCTTCGTCTCGTGTTCCACGACTCGATTGGTATCTCCCCCACTTTAGGGTACGCCCCCC
CTTAATTTTCCCGGAACATTTGCTAACGTCTATATATAGTGGAGGAGGCGCTGACGGTTCCATCGCCACCTTCAACGAGACGGAGCTCACCTTCCCCGCCAACCTCGGTATCGATGATGT
CCTCGACACGCTCGGCCCCTTCCTCTTCAAGCACTCCAATGTCATGACTCCCGGAGACTT
GTAAGACCCACTTTCTGATCCCACTCAAATTTCATTCGCTAATATTCCCTCGTAGCATTC
AACTCGCCGGCGCAGTCAGTCTGGTTCAGTGCCCCGGTGCCCCACGTATTCCTTTCTTCATGGGCCGCGCCCACCCCATAGCGGCGTCGCCCCCCGGCCTCGTTCCGGACCCCTTCGACA
GCGTCGAGTCCATCATGACGCGCTTCGGCGAGGTCGGCTTCCTGACCGCGGAGGAGGTCGTCGCCGTTGTCGGTGGATCTCACAGCGTTGCAGGCGCCGACGACATCGTGCCAAACCAGC
AAGGGGTACCCTTCGATCAGACTCCCTCCGTGTTCGACA
GTCAGTGGCCATTGTCATTTCTTCGGCACACAAATCCTCACATTTATTCTAGCCCAAATCTTCGTCGACGTTCAGCTCCGC
GGAACTCTGTTCACTGG
GTACGCACTTCGTGCTTCGATTTTCCCTCAATTCTGAATGAATTACTATTACAGCGAAGGAGGCCAGCAGGGGGAGGTCGAGACTGCAGTTGCCGGCACGGTA
CGCTTGCAGTCAGACCACCTT
GTAAGTCTTTCAGATTACCCTCAATATTACATATATTCTAATAGTTTATTCTCCAATAGCTCGCCCGTGACTCGGCGACGAACTGCGCCTGGCAGTCCT
TCGTCAACAACCAGCCCGCGATGGCCACCGCCTTCGGCCAGGGTGTCCTCAAGCTCTCCCTCCTCGGCCAGAATCAAAACGAG
GTAAGAAATACATCATTCACAAATCTTTCACCCAGCG
CTGACCTTCATTTTACCACACCAGCTGACCGACTGCAGCGAGGTCATCCCCGCCGCCCTCCCCTTCACTGGCGGCCCCGCGACCCTCCCCCCCGGTCTGACCATGAACGACATCGAGCAG
GCG
GTATGTAACCTCGCACTAAATTGCAATGCGCAACTAAAACTCGGCACAGTGCGCCACCGCGGCCTTCCCCTCGCTCGCGACCCAGCCCGGGCCACCGACCACGGTGCCCGCCATGTA
CGTTTCCTTCAATCACTTACCCTACTATCTGAAGCTGACGCGTCTTCTACAGCCCCCAGGCCGACGACTCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCGCTGCTCTCTCCGCCCTCGTTCTCGCTCTTCCTATCCTCTCGGTCAATGCTCTGAGGACCAGGCGCGCGCTGTGCCCCGACGGCATCAACACCGCTGTTAACCAGGCC
TGCTGTGCCCTGTTCCCCGTCGTCAAAGACCTCCAGGAAAACCTCTTTGAAGGCGAATGTGGTGACGCT
GCCCACGGTGCTCTTCGTCTCGTGTTCCACGACTCGATTGGTATCTCCCCC
ACTTTAGG
TGGAGGAGGCGCTGACGGTTCCATCGCCACCTTCAACGAGACGGAGCTCACCTTCCCCGCCAACCTCGGTATCGATGATGTCCTCGACACGCTCGGCCCCTTCCTCTTCAAG
CACTCCAATGTCATGACTCCCGGAGACTT
CATTCAACTCGCCGGCGCAGTCAGTCTGGTTCAGTGCCCCGGTGCCCCACGTATTCCTTTCTTCATGGGCCGCGCCCACCCCATAGCGGCG
TCGCCCCCCGGCCTCGTTCCGGACCCCTTCGACAGCGTCGAGTCCATCATGACGCGCTTCGGCGAGGTCGGCTTCCTGACCGCGGAGGAGGTCGTCGCCGTTGTCGGTGGATCTCACAGC
GTTGCAGGCGCCGACGACATCGTGCCAAACCAGCAAGGGGTACCCTTCGATCAGACTCCCTCCGTGTTCGACA
CCCAAATCTTCGTCGACGTTCAGCTCCGCGGAACTCTGTTCACTGGC
GAAGGAGGCCAGCAGGGGGAGGTCGAGACTGCAGTTGCCGGCACGGTACGCTTGCAGTCAGACCACCTT
CTCGCCCGTGACTCGGCGACGAACTGCGCCTGGCAGTCCTTCGTCAACAAC
CAGCCCGCGATGGCCACCGCCTTCGGCCAGGGTGTCCTCAAGCTCTCCCTCCTCGGCCAGAATCAAAACGAG
CTGACCGACTGCAGCGAGGTCATCCCCGCCGCCCTCCCCTTCACTGGC
GGCCCCGCGACCCTCCCCCCCGGTCTGACCATGAACGACATCGAGCAGGCG
TGCGCCACCGCGGCCTTCCCCTCGCTCGCGACCCAGCCCGGGCCACCGACCACGGTGCCCGCCATCCCC
CAGGCCGACGACTCTTAG

Retrieve as FASTA