Entry information : HsubCIIBB10
Entry ID 10564
Creation 2012-02-28 (Christophe Dunand)
Last sequence changes 2012-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Catherine
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: HsubCIIBB10
Name HsubCIIBB10
Class Other class II peroxidase type B    [Orthogroup: CIIBB002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Strophariaceae Hypholoma
Organism Hypholoma sublateritium    [TaxId: 71945 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HsubCIIBB10
start..stop
S start..stop
HsubCIIBB03 735 0 1..370 1..370
HsubCIIBB02 720 0 1..370 1..370
HsubCIIBB09 682 0 1..370 1..370
HsubCIIBB05 605 0 1..366 1..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10472..10532 61 N° 2 10583..10769 187 N° 3 10831..10971 141 N° 4 11031..11276 246
N° 5 11331..11365 35 N° 6 11416..11464 49 N° 7 11524..11593 70 N° 8 11649..11694 46
N° 9 11750..11826 77 N° 10 11885..11983 99 N° 11 12036..12100 65 N° 12 12155..12191 37
join(10472..10532,10583..10769,10831..10971,11031..11276,11331..11365,11416..114 64,11524..11593,11649..11694,11750..11826,11885..11983,12036..12100,12155..12191 )


exon

Literature and cross-references HsubCIIBB10
DNA ref. JGI genome:   scaffold_107 (10472..12191)
Cluster/Prediction ref. JGI gene:   47465
Protein sequence: HsubCIIBB10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (349)
PWM (Da):   %s   38373.19 (36137.0)  
PI (pH):   %s   4.22 (4.25) Peptide Signal:   %s   cut: 22 range:22-370
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFSAAFSAFVLALPLLSVNAARTKRALCPDGKNTAVNKACCALFPVVDDIVDNLFTNECGDSAHGALRLVFHDAIGISPTAGGGGADGSIATFNATELTFPANLGIDDVLDDLGPFILKHANTVTPGDFIQLAGAVSLVQCPGAPRIPFFMGRALPKAASPPNLVPQPTDDITTILERFGSVGFSPAEVVAVVGGSHSVAGADDVVPNFQGIPFDQTPSQFTQIFVDVLLHGTNFTDGGGPQSGESETAIAGTVRLQSDGLARDPRTACTWQSFVNEQSKMAAAFGAGVLKLSFLGQNERLTDCSEVIPAAKPANFGPATFPPTKSIRDIDLSCDEARFPDLRTEPGPAVTIAPIPQAVDSSGDDS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCGCTGCGTTCTCCGCATTTGTGCTCGCACTGCCCCTTCTCTCGGTCAATGGTAAGGGCAACATTTTTAAATTAGAGGATTCCGCTCATTATTACTTCCAGCTGCCAGGA
CCAAGCGCGCGTTGTGCCCGGACGGTAAAAACACTGCAGTCAACAAGGCGTGCTGTGCCCTGTTCCCTGTCGTCGATGACATAGTGGACAACCTTTTCACCAACGAATGCGGTGACTCGG
CTCACGGTGCCCTCCGTCTGGTTTTCCACGATGCCATTGGCATTTCCCCTACGGCTGG
GTTCGTCTAATCATACATTGAATGGGATATCACCAATATGCTAATATCTGAATGTACATAGT
GGTGGAGGTGCTGACGGATCTATTGCGACCTTCAACGCGACGGAACTGACCTTCCCTGCCAACCTCGGCATCGACGATGTCCTCGACGACCTTGGCCCGTTCATTCTCAAGCACGCCAAC
ACCGTCACTCCTGGAGACTT
GTAAGCATAATAAATCATTAACTGTAATGCACCCGCCGTTAACAGCATCCTATTTACAGCATTCAGCTCGCTGGAGCCGTGAGTCTGGTGCAGTGCCCAG
GTGCTCCCCGAATTCCGTTCTTCATGGGTCGTGCCCTACCCAAGGCCGCATCGCCCCCCAACCTCGTCCCCCAGCCAACTGACGACATCACCACCATCCTCGAGCGCTTCGGCTCGGTCG
GCTTCTCCCCCGCTGAGGTCGTCGCCGTTGTCGGTGGATCCCACAGTGTCGCCGGTGCCGATGACGTCGTGCCAAACTTCCAGGG
GTACGCCAAAGCATACTTTTACTTTCTATTTCGAT
CCTACTGACCTTCTTCAAGAATCCCCTTCGATCAAACTCCCTCTCAGTTTGACAGTATGTCTATTTTTGTGCTTGCTTCGATATTCTACTAACATATCGTTTAGCTCAGATCTTCGTTGA
CGTGCTTCTCCACGGAACCAACTTCACCGACGG
GTAGGCAAAATCTTTCCTAAATTCGGATTTGATATCAATTACACCTGCTATACCTGCAGTGGAGGCCCCCAGTCTGGTGAATCCGAG
ACTGCTATTGCTGGCACGGTGCGCTTGCAATCAGATGGACTT
GTTAGTTTCGTGAACAATATTTCACTATGACCATACTGAACACTGTGTACTACAGCTCGCTCGTGACCCAAGAACTGC
CTGCACATGGCAATCCTTCGTCA
GTGAGTGGTGATTCTATTTTTCGAAGATAAAATATTCATCCGGCATGTAATGCAGACGAGCAATCTAAGATGGCCGCAGCATTCGGCGCAGGTGTCC
TCAAGCTTTCCTTCTTGGGTCAGAATGAGCGCGAG
GTAATCAACGAGCTCCATGATACCAGCTCTAGCGCTTATATTCGCGGTGTACCCACAGTTGACCGACTGCAGCGAAGTCATCCCG
GCCGCCAAGCCCGCCAACTTTGGACCCGCTACTTTCCCGCCTACCAAGAGCATCCGCGATATCGACCTCTCT
GTGAGTTACACTTTTATACGGTATAGAACTGAATTCTCACAATTTTTG
ATAGTGCGACGAGGCCAGGTTCCCCGACCTCCGTACTGAGCCAGGCCCGGCGGTTACCATCGCTCCCATGTGCGTCAACTCATAATGCTGTTTATGTATTTTTTTCTGATCCGTATCTGT
TAGCCCCCAAGCTGTTGACAGCAGCGGCGACGACTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCGCTGCGTTCTCCGCATTTGTGCTCGCACTGCCCCTTCTCTCGGTCAATGCTGCCAGGACCAAGCGCGCGTTGTGCCCGGACGGTAAAAACACTGCAGTCAACAAGGCG
TGCTGTGCCCTGTTCCCTGTCGTCGATGACATAGTGGACAACCTTTTCACCAACGAATGCGGTGACTCGGCTCACGGTGCCCTCCGTCTGGTTTTCCACGATGCCATTGGCATTTCCCCT
ACGGCTGG
TGGTGGAGGTGCTGACGGATCTATTGCGACCTTCAACGCGACGGAACTGACCTTCCCTGCCAACCTCGGCATCGACGATGTCCTCGACGACCTTGGCCCGTTCATTCTCAAG
CACGCCAACACCGTCACTCCTGGAGACTT
CATTCAGCTCGCTGGAGCCGTGAGTCTGGTGCAGTGCCCAGGTGCTCCCCGAATTCCGTTCTTCATGGGTCGTGCCCTACCCAAGGCCGCA
TCGCCCCCCAACCTCGTCCCCCAGCCAACTGACGACATCACCACCATCCTCGAGCGCTTCGGCTCGGTCGGCTTCTCCCCCGCTGAGGTCGTCGCCGTTGTCGGTGGATCCCACAGTGTC
GCCGGTGCCGATGACGTCGTGCCAAACTTCCAGGG
AATCCCCTTCGATCAAACTCCCTCTCAGTTTGACACTCAGATCTTCGTTGACGTGCTTCTCCACGGAACCAACTTCACCGACGGT
GGAGGCCCCCAGTCTGGTGAATCCGAGACTGCTATTGCTGGCACGGTGCGCTTGCAATCAGATGGACTT
CTCGCTCGTGACCCAAGAACTGCCTGCACATGGCAATCCTTCGTCAACGAG
CAATCTAAGATGGCCGCAGCATTCGGCGCAGGTGTCCTCAAGCTTTCCTTCTTGGGTCAGAATGAGCGCGAG
TTGACCGACTGCAGCGAAGTCATCCCGGCCGCCAAGCCCGCCAACTTT
GGACCCGCTACTTTCCCGCCTACCAAGAGCATCCGCGATATCGACCTCTCT
TGCGACGAGGCCAGGTTCCCCGACCTCCGTACTGAGCCAGGCCCGGCGGTTACCATCGCTCCCATCCCC
CAAGCTGTTGACAGCAGCGGCGACGACTCTTAA

Retrieve as FASTA